help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published ahead of print on November 4, 2005, doi:10.1165/rcmb.2004-0275OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-0275OCv1
34/3/286    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, X.
Right arrow Articles by Ghio, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, X.
Right arrow Articles by Ghio, A. J.
American Journal of Respiratory Cell and Molecular Biology. Vol. 34, pp. 286-292, 2006
© 2006 American Thoracic Society
DOI: 10.1165/rcmb.2004-0275OC

Oxidant Generation Promotes Iron Sequestration in BEAS-2B Cells Exposed to Asbestos

Xinchao Wang, Yiming Wu, Jacqueline G. Stonehuerner, Lisa A. Dailey, Judy D. Richards, Ilona Jaspers, Claude A. Piantadosi and Andrew J. Ghio

Center for Environmental Medicine, Asthma, and Lung Biology, University of North Carolina, Chapel Hill; National Health and Environmental Effects Research Laboratory, Office of Research and Development, U.S. Environmental Protection Agency, Research Triangle Park; Duke University Medical Center, Durham, North Carolina; and School of Public Health, Zhengzhou University, Zhengzhou, Henan, People's Republic of China

Correspondence and requests for reprints should be addressed to Andrew J. Ghio, M.D., Campus Box 7315, Human Studies Division, U.S. EPA, 104 Mason Farm Road, Chapel Hill, NC 27599-7315. E-mail: ghio.andy{at}epa.gov


    Abstract
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Lung injury after asbestos exposure is associated with an oxidative stress that is catalyzed by iron in the fiber matrix, complexed to the surface, or both. We tested the hypothesis that the cellular response to asbestos includes the transport and sequestration of this iron through (1) generation of superoxide for ferrireduction, (2) up-regulation of divalent metal transporter-1 (DMT1) for intracellular transport of Fe2+, and (3) increased production of cellular ferritin where the metal is stored in a catalytically less reactive state. BEAS-2B cells with normal and elevated Cu,Zn superoxide dismutase (SOD) expression were employed for in vitro investigations. After exposure of these cells to asbestos, we demonstrated by fluorescence methodology a significantly increased generation of SOD with ferrireductive capacity. Fiber exposure also increased DMT1 protein and mRNA expression in the BEAS-2B cells. Incubation with asbestos elevated cellular iron and ferritin concentrations, and these responses were diminished in cells with an enhanced expression of SOD. Finally, fiber exposure increased supernatant concentrations of interleukin 8, but this inflammatory mediator was actually increased in cells with elevated SOD expression. We conclude that the response of respiratory epithelial cells to asbestos includes oxidant-mediated mechanisms to sequester catalytically active iron associated with the fiber.

Key Words: Nramp2 • free radicals • lung diseases • ferritin


    Introduction
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Asbestos fibers present an oxidative stress to the lung, which stimulates cell signaling (1, 2), transcription factor activation (3, 4) and inflammatory mediator release (5, 6). Pulmonary deposition of asbestos is associated with inflammatory, fibrotic, and neoplastic injuries in the human lung, and there is a relationship between oxidant production by asbestos and in vivo lung injury (7). However, the development of human disease after fiber inhalation depends on both time and dose, and only with prolonged and intense exposures does damage occur (8). This natural history suggests some means by which the adverse biological effects of asbestos might be mitigated in the lung.

Iron in the fiber matrix or complexed at the surface has been demonstrated to participate in the catalysis of oxidants (9, 10):

Formula

Because oxidants have been implicated in the biological effect of asbestos and injury after an exposure, the lung's response to fibers could include an attempt to transport and sequester this iron.

Ferrireductase activity appears to be required to transport iron in the lung (11). The chemical reduction of Fe3+ to Fe2+ during transport of non–transferrin-bound iron (NTBI) can be mediated by superoxide anion (Formula) (12, 13) produced by enzymes such as NAD(P)H: flavin oxidoreductases at the cell surface where metal reduction occurs (14, 15). Formula reduces Fe3+ by releasing the iron from its chelator, allowing it to be transported into the lung cells (16).

Detoxification also requires the metal to be transported across the cell membrane after it is reduced to the ferrous state. Iron is frequently transferred across membranes via transferrin and its receptor (17). However, although transferrin plays a major role in nutritional uptake of iron, the metal it transports appears to be released into a catalytically active low-molecular-weight pool rather than sequestered by a storage protein (18). Such delivery is not consistent with detoxification of the metal. The transport of NTBI provides an alternative means of metal uptake that involves natural resistance-associated macrophage proteins (Nramp), a group of structurally and functionally related transporter proteins conserved across numerous vertebrate species. Nramp2, also called divalent metal transporter-1 (DMT1), is expressed in most tissues and cells as an integral membrane protein (molecular weight of 90–100 kD) modified by glycosylation (19).

DMT1 generates alternative mRNAs that differ at their 3' untranslated region by the presence or absence of an iron response element (+IRE and –IRE, respectively) allowing post-transcriptional regulation in response to iron levels (20, 21). The placement of the IRE at the 3' untranslated region predicts that exposure to iron would decrease DMT1 expression. Such post-transcriptional regulation of the +IRE isoform has been demonstrated in duodenal cells with iron depletion (22, 23). Although this response is effective for iron acquisition in the intestine, it is in direct contrast to that required to detoxify iron in the lung. Airway epithelial cells exposed to iron show an increase in mRNA and protein expression of the –IRE isoform of DMT1 (24). Such transcriptional control of DMT1 provides an alternative means of regulation by iron concentration. In cells that are not designed to meet nutritional requirements, the control of DMT1 by iron provides a regulated mechanism to diminish oxidative stress and injury by this metal (25). DMT1 could also participate in a response to iron in a solid chelate, such as asbestos, by removing metal from the fiber to a cellular site where it is catalytically inactive. Ultimately, this iron is transported to the final storage site of ferritin. In certain cells, intracellular ferritin functions as an antioxidant and offers cytoprotection against oxidants (2629).

We therefore tested the hypothesis that respiratory airway epithelial cells respond to asbestos by transporting and sequestering iron. Specifically, we were interested in (1) generation of Formula, which can chemically reduce fiber-associated iron to the ferrous state; (2) an increase in DMT1 to transport the Fe2+; (3) changes in concentrations of both cell iron and ferritin reflecting iron's isolation in a catalytically less reactive state; and (4) cellular mediator release.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Reagents
Crocidolite fibers were provided by the National Institute for Environmental Health Sciences (Research Triangle Park, NC). Tissue culture medium, supplements, and supplies were from Clonetics (San Diego, CA). BSA, 2-mercaptoethanol, lactate dehydrogenase (LDH) assay kits and other laboratory chemicals were purchased from Sigma Chemical (St. Louis, MO). The 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA) and dihydroethidium (DHE) were from Molecular Probes (Eugene, OR). Guanidine thiocyanate was purchased from Boehringer Mannheim (Indianapolis, IN), TaqMan Universal PCR Master Mix from Hoffman-LaRoche (Branchburg, NJ), RNeasy kit from Qiagen, Inc. (Valencia, CA), and RiboGreen RNA quantitation kit from Molecular Probes. Maloney murine leukemia virus reverse transcriptase, NuPAGE gels, reducing agent, antioxidant, and loading, running, and transfer buffers were from Invitrogen (Carlsbad, CA). Specific anti-DMT1 ± IRE antibodies were obtained from ADI Co. (San Antonio, TX). Horseradish peroxidase (HRP)–conjugated goat anti-rabbit secondary antibody was from Santa Cruz Biotechnology (Santa Cruz, CA). Protease inhibitor cocktail set III was purchased from Calbiochem (San Jolla, CA) and ECL from Amersham Biosciences (Piscataway, NJ). The interleukin (IL)-8 immunobioassay kit was obtained from R&D Systems (Minneapolis, MN).

Cell Culture
BEAS-2B cells (S6 subclone, passages 68–80), obtained courtesy of Drs. Curtis Harris and John Lechner from the National Institutes of Health, were also used in some studies. This is an immortalized line of normal human bronchial epithelium derived by transfection of primary cells with SV40 early-region genes. This particular subclone undergoes squamous differentiation in response to serum. Cells were grown to 90–100% confluence on uncoated, plastic 12-well plates in ketinocyte growth medium (KGM), which is essentially MCDB 153 medium supplemented with 5 ng/ml human epidermal growth factor, 5 mg/ml insulin, 0.5 mg/ml hydrocortisone, 0.15 mM calcium, bovine pituitary extract, 0.1 mM ethanolamine, and 0.1 mM phosphoethanolamine.

Infection with Adenovirus
BEAS-2B cells grown to 90% confluence were infected with AdSOD1 at multiple infection equivalents up to 100 plaque-forming units/cell (30). Control cells were infected with Ad5CMV3, the medium was aspirated, and the cells were incubated for another 48 h before use. Increased superoxide dismutase (SOD) expression was confirmed by a functional assay using nitroblue tetrazolium and Western blot analysis (31). To measure catalase, cells were washed with PBS, scraped, and centrifuged at 1,200 rpm for 10 min. Pellets were sonicated in 0.5 ml 100 mM phosphate buffer (pH 7.0) and centrifuged at 10,000 rpm for 30 min. Activity in the supernatants was assayed. The decomposition of H2O2 in a 1.0-ml mixture of cell supernatant, 100 mM phosphate buffer (pH 7.0), and 10 mM H2O2 was followed by measuring the decrease in absorbance at 240 nm. Enzyme activity was expressed in micromoles of H2O2 decrease per minute per milligram of protein.

Ferricytochrome C Reduction by BEAS-2B Cells
To increase sensitivity of the assay for a product of aerobic metabolism, BEAS-2B cells were grown at an air–liquid interface. Cells were plated on collagen-coated filters with a 0.4-µm pore size (Trans-CLR; Costar, Cambridge, MA) at a density of 1 x 105 cells/filter and inserted into 12-well culture plates. At 90–100% confluence, 50 µl 50 µM ferricytochrome C was added to the apical chamber. After 0-, 15-, 30-, and 60-min incubations, the apical chamber was sampled and the wavelengths at 550 and 540 nm were measured. The 550-nm wavelength is considered to measure the peak of the reduced ferricytochrome C, whereas the 540-nm wavelength does not change, therefore functioning as a reference for light scattering.

Exposure of BEAS-2B Cells to Crocidolite
A suspension of 5 mg/ml crocidolite was prepared in Hanks' balanced salt solution (HBSS) and used as a stock for dilution into KGM. LDH concentration in the cell supernatant was measured using a commercially prepared kit as modified for automated measurement (Cobas Fara II centrifugal analyzer; Hoffman-LaRoche). Results were expressed as a percentage of a positive control measured after scraping BEAS-2B cells and lysing them with five passages through a 25-gauge needle.

Oxidative Stress Measured by Dichlorodihydrofluorescein Fluorescence and Fluorescence Microscopy
Oxidant generation by BEAS-2B cells was determined using dichlorodihydrofluorescein (DCF) fluorescence. BEAS-2B cells, both with and without increased SOD expression, were grown to 90–100% confluence. The cells were loaded with 10 µM DCFH-DA in KGM for 30 min. After washing with PBS, BEAS-2B cells were exposed to either media or 100 µg/ml crocidolite in media and incubated at 37°C in 5% CO2. DCFH-DA is cleaved intracellularly, resulting in a non–fluorescent-charged molecule that cannot cross the membrane. DCFH-DA can be oxidized to DCF, which is a fluorescent product. Fluorescence of DCF was measured on a spectrofluorimeter with excitation and emission set at 485 and 535 nm, respectively. Oxidant generation was expressed as the ratio of fluorescence relative to cells with no exposure to asbestos.

Oxidant generation in BEAS-2B cells was also demonstrated using fluorescence microscopy. BEAS-2B cells, both with and without increased SOD expression, were grown to 90–100% confluence in 12-well plates and exposed to either media or 100 µg/ml crocidolite in media for 2 h. Media and asbestos were then removed, fresh KGM with 10 µM DHE was added for 15 min, and the cells examined under an inverted Axiovert 10 microscope (Carl Zeiss, Inc., Thornwood, NY). Excitation and emission were set at 520 and 610 nm, respectively, and fluorescence was captured using a DEI 750 system (Meyer Instruments, Houston, TX).

RNA Isolation and Real-Time PCR
BEAS-2B cells, both with and without increased SOD expression, grown to 90% confluence were exposed to media or 100 µg/ml crocidolite. Cells were lysed with 4 M guanidine thiocyanate, 50 mM sodium citrate, 0.5% sarkosyl, and 0.01 M dithiothreitol. After the cells were dislodged from wells with scrapers, lysates were sheared with four passes through a 22-gauge needle. RNA was isolated using RNeasy kit and RNA concentration was measured by using RiboGreen RNA quantitation kit. Total RNA (200 ng) was reverse-transcribed into cDNA. Quantitative PCR was performed on a sequence detector (ABI Prism 7700, PE Biosystems, Foster City, CA). DMT1 mRNA levels were normalized using the expression of GAPDH as a reference gene. DMT1 and GAPDH mRNA expression ratios were based on standard curves prepared for serially diluted cDNA from human BEAS-2B cells. The following sequences were employed:

DMT1 (+IRE): 5' TGGCAATGTTTGATTGC 3' and 5' AGAAAA CACACTGGCTCTGAT 3'

DMT1 (–IRE): 5' TTTGTCGTCACTTTTCTTGAATTGTT 3' and 5' GGTTTCTGGATCTTGTTACTGGATATT 3'

GAPDH: 5' GGAGGTGAAGGTCGGAGTC 3' and 5' GAAGATG GTGATGGGATTTC 3'

Western Blot Analysis for DMT1 ± IRE
BEAS-2B cells, both with and without increased SOD expression, were exposed to either media or 100 µg/ml crocidolite for 24 h, rinsed twice with PBS, scraped in 80 µl of RIPA buffer (1% nonidet P-40, 0.5% deoxycholate, and 0.1% SDS in PBS, pH 7.4) containing protease inhibitors, and sheared through a 22-gauge needle. Protein concentration was determined using the Bradford assay (Bio-Rad, Hercules, CA). Samples (50 µg) were separated by electrophoresis on a 4–15% SDS acrylamide gel and transferred to a nitrocellulose membrane. The membrane was blocked with 3% nonfat milk in PBS, incubated with an antibody directed against the DMT1 ± IRE, washed, and incubated with a horseradish peroxidase–conjugated goat anti-rabbit IgG antibody (1:1,000; Santa Cruz Biotechnology) and developed using ECL. Intensities of the visualized protein bands were quantified using a Millipore Digital Bioimaging System (Bedford, MA).

Cell Iron Concentrations
BEAS-2B cells grown to 90–100% confluence on plastic 12-well plates in 1.0 ml KGM were exposed to media or 100 µg/ml crocidolite. At specified times, media and fibers were removed. Cells were washed twice with HBSS and scraped into 1.0 ml 3 N HCl/10% trichloroacetic acid. After hydrolysis at 70°C for 18 h and centrifugation to remove precipitated heme, the iron concentration in the supernatant was determined using inductively coupled plasma atomic emission spectroscopy (model P30; Perkin Elmer, Norwalk, CT) at a wavelength of 238.204 nm. A single-element standard was used to calibrate the instrument (Fisher, Pittsburgh, PA).

Measurement of Ferritin Concentration
Cells grown to 90–100% confluence in 12-well plates were exposed to media or 100 µg/ml crocidolite in media for 24 h. Media and fibers were removed. Cells were washed twice with HBSS, dislodged into 200 µl of HBSS, and sheared through a 22-gauge needle. Ferritin protein concentration was analyzed using a commercially available kit (an enzyme immunoassay) from Microgenics (Concord, CA). This assay was modified for use in the Cobas Fara II centrifugal spectrophotometer (Hoffman-LaRoche).

Determination of IL-8 Release by BEAS-2B Cells
Cells grown to 90–100% confluence in 12-well plates were exposed to media or crocidolite in media for 24 h at 37°C in 5% CO2. Supernatant was collected and frozen for subsequent determination. IL-8 protein was determined using Quantikine kits (R&D Systems), following the manufacturer's recommendations.

Statistics
Grouped data are presented as means ± SE (n = 3–6 samples). All experiments were repeated at least once. Differences between multiple groups were compared using one-way analysis of variance with Scheffe's posthoc test. The level of significance was assumed at P < 0.05.


    RESULTS
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
The activity of SOD in BEAS-2B cells infected with Ad5CMV3 and AdSOD1 was 0.24 ± 0.42 and 11.60 ± 1.64 units/mg protein, respectively. Differences in SOD expression between the two cell types were confirmed by Western blot analysis (data not shown). Catalase values revealed no differences between the SOD normal and increased cells (3.24 ± 0.29 and 3.39 ± 0.64 µmol H2O2/min/mg protein, respectively). The assay for ferricytochrome C reduction demonstrated that Formula was generated by the BEAS-2B cells grown at an air–liquid interface and that increased SOD expression decreased this significantly (Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. FERRICYTOCHROME C REDUCTION BY BEAS-2B CELLS GROWN AT AN AIR–LIQUID INTERFACE

 
Exposure of BEAS-2B cells to crocidolite fibers at 0, 100, 250, and 500 µg/ml was associated with supernatant LDH values of 6.2 ± 0.7%, 6.1 ± 0.7%, 8.5 ± 0.9%, and 9.4 ± 1.1% at 24 h. LDH release at the two highest concentrations of fiber was significantly elevated and we therefore elected to employ 100 µg/ml crocidolite for the remaining studies. Increased SOD expression did not affect cytotoxicity.

We used DCF fluorescence to demonstrate nonspecific generation of reactive oxygen species by respiratory epithelial cells exposed to asbestos. Incubation of BEAS-2B cells with crocidolite asbestos was associated with an increase in the fluorescent signal within an hour of exposure (Figure 1A), indicating an oxidative stress. Overexpression of SOD in the BEAS-2B cells decreased the fluorescence (Figure 1B), suggesting that Formula participated in the signal for DCF fluorescence after exposure to the fiber. To confirm that oxidative stress was associated with asbestos, we used fluorescence microscopy and, comparable to DCF oxidation, found increased fluorescence by DHE after crocidolite exposure (Figure 2). BEAS-2B cells with overexpression of SOD demonstrated a reduced fluorescence signal consistent with less superoxide generation after fiber exposure (Figure 2).


Figure 1
View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. Oxidative stress in BEAS-2B cells using DCF fluorescence. BEAS-2B cells were pretreated with 10 µM of 2',7'-DCFH-DA for 30 min. After washing, BEAS-2B cells with and without increased SOD expression were then exposed to either media or 100 µg crocidolite/ml media for different durations of time. Asbestos exposure significantly increased the fluorescence signal relative to media only (A). An increased expression of SOD diminished this signal at 60 min (B).

 

Figure 2
View larger version (105K):
[in this window]
[in a new window]
 
Figure 2. Oxidative stress in BEAS-2B cells after exposure to crocidolite using fluorescence microscopy. BEAS-2B cells with and without increased SOD expression were exposed to 100 µg/ml of crocidolite for 2 h. At the end of the incubation, the media was removed and 1.0 ml media containing 10 µM DHE was added to each well. Excitation and emission were set at 520 and 610 nm to detect oxidative stress. The fluorescence signal is stronger in BEAS-2B cells exposed to crocidolite (upper right) compared with those incubated with media only (upper left). The signal in cells with increased SOD expression exposed to media was comparable to cells without elevated SOD expression (lower left). However, respiratory epithelial cells with increased SOD expression demonstrated less fluorescence after crocidolite exposure relative to cells without SOD overexpression incubated with fibers (lower right).

 
Soluble iron chelates have been demonstrated to up-regulate RNA and protein expression of DMT1 without an IRE in respiratory epithelial cells both in vitro and in vivo (24). In contrast, RNA and protein for the +IRE isoform does not change after exposure of respiratory epithelial cells to soluble iron chelates (24). After incubating the BEAS-2B cells with fibers for 4 h, RT-PCR showed no change in mRNA for the +IRE DMT1 relative to media alone (Figure 3A). In contrast, RNA for –IRE DMT1 showed an increase after a 4-h asbestos exposure (Figure 3A). Comparable to RNA, protein analysis by Western blot showed no change in +IRE DMT1 expression after 24 h exposure to crocidolite, whereas the –IRE DMT1 was increased (Figures 3B and 3C). SOD overexpression by the BEAS-2B cells had no effect on RNA for –IRE DMT1 (Figure 3A). Corresponding to the RNA levels, protein analysis by Western blot indicated no effect of SOD up-regulation on DMT1 protein expression (Figures 3B and 3C).


Figure 3
View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. (A) mRNA for DMT1 after exposure of BEAS-2B cells to crocidolite. BEAS-2B cells with and without increased SOD expression were exposed to media or 100 µg/ml crocidolite for 4 h. Cells were lysed and sheared. mRNA was isolated and reverse-transcribed into cDNA. DMT1 and GAPDH mRNA were based on standard curves prepared for serially diluted cDNA from BEAS-2B cells. mRNA for DMT1 ± IRE were normalized using the expression of GAPDH. Results indicate an increase in –IRE DMT1 RNA after exposure to crocidolite, whereas there was no effect on that isoform with an IRE (DMT1/GAPDH values of 1.1 ± 0/4 and 1.4 ± 0.5 with media and crocidolite exposure, respectively). Increased expression of SOD by the BEAS-2B cells had no effect on levels of mRNA. * Significant increase relative to incubation with media; n = 6/ exposure. (B, C) Western blot analysis for –IRE DMT1 in BEAS-2B cells after exposure to crocidolite. BEAS-2B cells with and without increased SOD expression were exposed to media or 100 µg/ml crocidolite for 24 h. Asbestos increased –IRE DMT1 expression while having little effect on that isoform with an IRE. Increased expression of SOD by the BEAS-2B cells had no discernible effect on the expression of DMT1. Lanes in B represent exposure to media (1 and 5)and crocidolite (2 and 6) in normal BEAS-2B cells and media (3 and 7) and crocidolite (4 and 8) in BEAS-2B cells with an elevated expression of SOD. Data are representative at least three separate experiments. The band reflects a protein with a molecular weight of approximately 90 kD. The intensity of this band was greater with exposure to crocidolite regardless of SOD expression by the cell. The negative (type 55 film; Polaroid Corp., Cambridge, MA) was quantitated using a BioImage Densitometer (BioImage, Ann Arbor, MI). Densitometry measurements for –IRE DMT1 are graphed relative to bands exposed to media only in those cells with normal expression of SOD (i.e., those cells treated with Ad5CMV3). * Significant increase relative to incubation with media; n = 2/exposure.

 
The crocidolite fiber we used has been demonstrated to be associated with concentrations of catalytically active metal (32). Although a 1-h incubation with 100 µg/ml crocidolite did not significantly increase nonheme iron concentration relative to control BEAS-2B cells exposed to media alone, iron concentration was elevated at both 4 and 24 h (Figure 4). The concentration of nonheme iron was greatest after 4 h of exposure and significantly less at 24 h (but still increased relative to control cells). SOD overexpression decreased intracellular iron uptake at both 4 and 24 h of asbestos exposure but did not eradicate it (Figure 4).


Figure 4
View larger version (28K):
[in this window]
[in a new window]
 
Figure 4. Iron uptake by BEAS-2B after exposure to asbestos. BEAS-2B cells with and without increased SOD expression were exposed to media or 100 µg/ml crocidolite for 1, 4, and 24 h. Medium (with fibers, if present) was removed and the cells were washed and scraped into acid. After hydrolysis, the concentration of iron was determined using inductively coupled plasma optical emission spectroscopy. There were significant increases in iron concentration at 4 and 24 h after exposure to crocidolite. SOD decreased the uptake of iron. * Significant increase relative to incubation with media; n = 6/exposure.

 
In respiratory epithelial cells, iron transport using –IRE DMT1 can limit the capacity of metal to generate oxidative stress (33). This must be coupled with storage of iron at a site that restricts its catalytic potential, such as ferritin. Relative to control, ferritin concentration in BEAS-2B cells increased significantly after 24-h exposure to asbestos (Figure 5). SOD overexpression affected this response by decreasing the concentration of ferritin after 24-h exposure to crocidolite (Figure 5).

Finally, as a marker of biological effect, we evaluated IL-8 released by respiratory epithelial cells after exposure to asbestos (34, 35). IL-8 concentrations in the cell supernatant were increased significantly after 24-h incubations of the BEAS-2B cells with asbestos (Figure 6). SOD overexpression, however, actually increased IL-8 release after exposure of the BEAS-2B cells to crocidolite asbestos (Figure 6).


Figure 5
View larger version (15K):
[in this window]
[in a new window]
 
Figure 5. Ferritin concentration in BEAS-2B cells after crocidolite exposure. BEAS-2B cells with and without increased SOD expression were exposed to media or 100 µg/ml crocidolite for 24 h. Medium (with fibers, if present) was removed, the cells were washed and scraped into HBSS. The ferritin concentration was determined using a commercially available enzyme immunoassay. There were significant increases in cell ferritin after exposure to asbestos. The elevation in ferritin was decreased in cells with an increased expression of SOD. * Significant increase relative to incubation with media; n = 6/exposure. ** Significant decrease relative to SOD normal cells; n = 6/exposure.

 

Figure 6
View larger version (15K):
[in this window]
[in a new window]
 
Figure 6. IL-8 release after exposure of BEAS-2B cells to crocidolite. BEAS-2B cells with and without increased SOD expression were exposed to media or 100 µg/ml crocidolite for 24 h. After the incubations, the supernatants were collected and IL-8 concentration determined using Quantikine kits. The release of IL-8 by BEAS-2B cells was increased after exposure to asbestos. Increased expression of SOD by the BEAS-2B cells was associated with elevations in IL-8 concentrations in the supernatant. * Significant increase relative to incubation with media; n = 6/exposure. ** Significant increase relative to SOD normal cells; n = 6/exposure.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Metal-catalyzed oxidative stress (e.g., hydroxyl, ferryl, and perferryl radical generation) associated with asbestos presents the potential for lung injury, and removing metal from the fiber can diminish the generation of free radicals (32). All cells normally transport iron to meet their functional needs and many cells appear to detoxify iron; both types of transport require ferrireductase activity (11). Small organic compounds such as malate and lactate are sometimes used to reduce Fe3+ (36, 37). Alternatively, cells can employ superoxide for ferrireduction (24) and chemically dissociate the iron from the chelate outside the cell, allowing uptake of only the metal (38). In our BEAS-2B cells, oxidant generation immediately followed exposure to asbestos, and a significant portion of this oxidative response was inhibited by increasing the cell's SOD expression. These findings support the specific production of Formula by the epithelial cell, which appeared to precede any significant elevation of cellular iron concentration. This Formula generation is therefore unlikely to reflect intracellular catalysis by the metal. It is more likely that this oxidant generation reduces ferric to ferrous ion to transport the metal away from the fiber and sequester it in the epithelial cell.

Iron is transported across plasma membranes by metal carrier proteins, such as DMT1, only in the ferrous state (22). Metal transport by DMT1 is coupled to proton movement, depends on the cell's membrane potential, and may include other divalent cations, such as manganese, cobalt, nickel, zinc, copper, lead, and cadmium. When respiratory epithelial cells are exposed to soluble iron chelates, only the DMT1 isoform without an IRE increases (24), which implicates this protein in detoxification of catalytically active metal. In this study, exposure of BEAS-2B cells to crocidolite increased both the mRNA and protein expression of DMT1 but, like exposure to soluble iron chelates, crocidolite specifically increased only the –IRE isoform. This suggests transcription of DMT1 permits the protein to function in controlling oxidative stress by iron. The increased expression of SOD had no significant effect on DMT1 expression in BEAS-2B cells after fiber exposure. This lack of effect of SOD overexpression may reflect the incomplete inhibition of iron uptake by the SOD or a low threshold requirement for metal in the induction of –IRE DMT1 in BEAS-2B cells (i.e., the protein may be up-regulated by small amounts of iron). Furthermore, PCR and Western blot analysis are semiquantitative methodologies and may not have the sensitivity required to detect small changes.

In the present study, epithelial cells transported iron intracellularly that was first associated with the asbestos fibers. This likely reflects the epithelial cells' role in controlling oxidative stress (32). Iron uptake by BEAS-2B cells occurred 4 and 24 h after exposure to crocidolite asbestos. There was no obvious crocidolite associated with the cells by light microscopy after washing off the fibers from the monolayers. Although endocytosis of fibers by this cell type does occur (39), previous experience suggests that it is uncommon. In addition, some of the metal taken up by the cells at 4 h was released later. These data also imply transport of the asbestos-associated metal rather than an endocytosis of the fiber that accounts for change in the cell iron concentration. An increased expression of SOD diminished the uptake of metal supporting a role for Formula in the metal transport process.

The cellular uptake of iron associated with asbestos fibers can diminish oxidative stress only if the metal is sequestered in a less reactive state. The sequestration site most frequently employed by all cells is ferritin. Iron storage by ferritin limits the metal's capacity to generate free radicals and confers an antioxidant function to this protein. Ferritin synthesis is regulated by a post-transcriptional mechanism involving an IRE at the 5'-untranslated end of ferritin mRNA, which binds to a cubane iron-sulfur cluster, the iron regulatory protein (IRP) (40, 41). Iron transported from the crocidolite into the cell is proposed to react with the IRP, decreasing the protein's affinity to the IRE. Subsequently, the IRP is displaced from the mRNA and the translation of ferritin proceeds. The concentration of ferritin in BEAS-2B cells increased after exposure to asbestos, indicating a role for it in the response to the fibers. The concentration of ferritin was decreased in cells that expressed SOD at high levels by transfection. This, too, is consistent with the lower intracellular iron levels produced by SOD overexpression. Increased SOD activity decreases reductant availability and ferrireduction, and therefore cellular uptake of metal. Decreased intracellular metal concentrations would then limit ferritin expression through the post-transcriptional control described above.

Finally, the relationship between biological effects of asbestos and iron transport was examined using changes in the levels of IL-8, which reflect the inflammatory effects of the fiber (34, 35). We found that IL-8 concentrations significantly increased after incubating BEAS-2B cells with the fiber. Overexpression of SOD in BEAS-2B cells was accompanied by increased IL-8 release, which is consistent with a role for iron transport by the epithelial cells in controlling the inflammatory effect of crocidolite. In other words, after fiber exposure, the metal does not mediate the same biological effect after its uptake by the cell. This is expected because the iron is sequestered in a catalytically less reactive state by ferritin, and IL-8 is produced in response to the oxidative stress of the fiber. Prooxidative events have been associated with SOD (42). An effect on iron metabolism may be one mechanism by which SOD affects such an event. Formula can facilitate transport of catalytically active iron with its subsequent sequestration. SOD would inhibit this reaction; an increased oxidative stress would be the result.

In conclusion, respiratory epithelial cells respond to asbestos by the production of oxidative stress, increased expression of DMT1, cellular uptake of iron, ferritin expression, and IL-8 release. Among the oxidants produced by the respiratory epithelial cell after exposure to asbestos is superoxide, which is an important iron reductant. Interference with Formula production by the BEAS-2B cells diminishes iron uptake and ferritin expression. This implicates superoxide in the intracellular transport of iron initially associated with the fiber; this iron is then sequestered in ferritin, which restricts the biological activity of the metal. The reduction of Fe3+ to Fe2+ by superoxide allows metal carrier proteins, like DMT1, to transport the metal across the cell membrane to ferritin. This mechanism contributes to diminishing the oxidative stress presented by the reactive metal associated with the fiber. If this pathway of sequestration is interrupted, metal will remain catalytically active and increase the inflammatory response to the fiber.


    Footnotes
 
This report has been reviewed by the National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, and approved for publication. Approval does not signify that the contents necessarily reflect the views and policies of the Agency nor does mention of trade names or commercial products constitute endorsement or recommendation for use.

Originally Published in Press as DOI: 10.1165/rcmb.2004-0275OC on November 4, 2005

Conflict of Interest Statement: None of the authors has a financial relationship with a commercial entity that has an interest in the subject of this manuscript.

Received in original form August 26, 2004

Accepted in final form September 22, 2005


    References
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 

  1. Mossman BT, Faux S, Janssen Y, Jimenez LA, Timblin C, Zanella C, Goldberg J, Walsh E, Barchowsky A, Driscoll K. Cell signaling pathways elicited by asbestos. Environ Health Perspect 1997;105:1121–1125.
  2. Swain WA, O'Byrne KJ, Faux SP. Activation of p38 MAP kinase by asbestos in rat mesothelial cells is mediated by oxidative stress. Am J Physiol 2004;286:L859–L865.
  3. Beswick PH. Free radical activity of industrial fibers: role of iron in oxidative stress and activation of transcription factors. Environ Health Perspect 1997;105:1313–1317.
  4. Gilmour PS, Brown DM, Beswick PH, MacNee W, Rahman I, Donaldson K. Free radical activity of industrial fibers: role of iron in oxidative stress and activation of transcription factors. Environ Health Perspect 1997;105:1313–1317.
  5. Simeonova PP, Luster MI. Iron and reactive oxygen species in the asbestos-induced tumor necrosis factor-alpha response from alveolar macrophages. Am J Respir Cell Mol Biol 1995;12:676–683.[Abstract]
  6. Luster MI, Simeonova PP. Asbestos induces inflammatory cytokines in the lung through redox sensitive transcription factors. Toxicol Lett 1998;28:102–103.
  7. Mossman BT, Marsh JP, Sesko A, Hill S, Shatos MA, Doherty J, Petruska J, Adler KB, Hemenway D, Mickey R, et al. Inhibition of lung injury, inflammation, and interstitial pulmonary fibrosis by polyethylene glycol-conjugated catalase in a rapid inhalation model of asbestosis. Am Rev Respir Dis 1990;141:1266–1271.[Medline]
  8. American Thoracic Society. The diagnosis of nonmalignant diseases related to asbestos. Am Rev Respir Dis 1986;134:363–368.[Medline]
  9. Lund LG, Aust AE. Iron-catalyzed reactions may be responsible for the biochemical and biological effects of asbestos. Biofactors 1991;3:83–89.[Medline]
  10. Kamp DW, Graceffa P, Pryor WA, Weitzman SA. The role of free radicals in asbestos-induced diseases. Free Radic Biol Med 1992;12:293–315.[CrossRef][Medline]
  11. Turi JL, Yang F, Garrick MD, Piantadosi CA, Ghio AJ. The iron cycle and oxidative stress in the lung. Free Radic Biol Med 2004;36:850–857.[CrossRef][Medline]
  12. Cakmak I, van de Wetering DAM, Marschner H, Bienfait HF. Involvement of superoxide radical in extracellular ferric reduction by iron-deficient bean roots. Plant Physiol 1987;85:310–314.[Abstract/Free Full Text]
  13. de la Guardia MD, Alcantara E. Ferric chelate reduction by sunflower (Helianthus annuus L.) leaves: influence of light, oxygen, iron- deficiency and leaf age. J Exp Bot 1996;47:669–675.[Abstract/Free Full Text]
  14. Buckhout TJ, Bell PF, Luster DG, Chaney RL. Iron-stress induced redox activity in tomato (Lycopersicum esculentum Mill.) is localized on the plasma membrane. Plant Physiol 1989;90:151–156.[Abstract/Free Full Text]
  15. Bienfait HF, Bino RJ, van der Bliek AM, Duivenvoorden JF, Fontaine JM. Characterization of ferric reducing activity in roots of Fe-deficient Phaseolus vulgaris. Physiol Plant 1983;59:196–202.[CrossRef]
  16. Bienfait HF. Regulated redox processes at the plasmalemma of plant root cells and their function in iron uptake. J Bioenerg Biomembr 1985;17:73–83.[CrossRef][Medline]
  17. Aisen P, Listowsky I. Iron transport and storage proteins. Annu Rev Biochem 1980;49:357–393.[CrossRef][Medline]
  18. Breuer W, Epsztejn S, Cabantchik ZI. Iron acquired from transferrin by K562 cells is delivered into a cytoplasmic pool of chelatable iron(II). J Biol Chem 1995;270:24209–24215.[Abstract/Free Full Text]
  19. Vidal S, Belouchi A-M, Cellier M, Beatty B, Gros P. Cloning and characterization of a second human NRAMP gene on chromosome 12q13. Mamm Genome 1995;6:224–230.[CrossRef][Medline]
  20. Lee PL, Gelbart T, West C, Halloran C, Beutler E. The human Nramp2 gene: characterization of the gene structure, alternative splicing, promoter region and polymorphisms. Blood Cells Mol Dis 1998;24:199–215.[CrossRef][Medline]
  21. Lash A, Saleem A. Iron metabolism and its regulation: a review. Ann Clin Lab Sci 1995;25:20–30.[Abstract]
  22. Gunshin H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, Gollan JL, Hediger MA. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 1997;388:482–488.[CrossRef][Medline]
  23. Han O, Fleet JC, Wood RJ. Reciprocal regulation of HFE and Nramp2 gene expression by iron in human intestinal cells. J Nutr 1999;129:98–104.[Abstract/Free Full Text]
  24. Wang X, Ghio AJ, Yang F, Dolan KG, Garrick MD, Piantadosi CA. Iron uptake and Nramp2/DMT1/DCT1 in human bronchial epithelial cells. Am J Physiol 2002;282:L987–L995.
  25. Trinder D, Oates PS, Thomas C, Sadleir J, Morgan EH. Localisation of divalent metal transporter 1 (DMT1) to the microvillus membrane of rat duodenal enterocytes in iron deficiency, but to hepatocytes in iron overload. Gut 2000;46:270–276.[Abstract/Free Full Text]
  26. Balla G, Jacob HS, Balla J, Rosenberg M, Nath K, Apple F, Eaton JW, Vercellotti GM. Ferritin: a cytoprotective antioxidant strategem of endothelium. J Biol Chem 1992;267:18148–18153.[Abstract/Free Full Text]
  27. Olakanmi O, McGowan SE, Hayek MB, Britigan BE. Iron sequestration by macrophages decreases the potential for extracellular hydroxyl radical formation. J Clin Invest 1993;91:889–899.
  28. Balla J, Nath DA, Balla G, Juckett MB, Jacob HS, Vercellotti GM. Endothelial cell heme oxygenase and ferritin induction in rat lung by hemoglobin in vivo. Am J Physiol 1995;268:L321–L327.
  29. Cozzi A, Santambrogio P, Levi S, Arosio P. Iron detoxifying activity of ferritin: effects of H and L human apoferritins on lipid peroxidation in vitro. FEBS Lett 1990;277:119–122.[CrossRef][Medline]
  30. Ghio AJ, Nozik-Grayck E, Turi J, Jaspers I, Mercatante DR, Kole R, Piantadosi CA. Superoxide-dependent iron uptake: a new role for anion exchange protein. Am J Respir Cell Mol Biol 2003;29:653–660.[Abstract/Free Full Text]
  31. Spitz DR, Oberley LW. An assay for superoxide dismutase activity in mammalian tissue homogenates. Anal Biochem 1989;179:8–18.[CrossRef][Medline]
  32. Ghio AJ, Zhang J, Piantadosi CA. Generation of hydroxyl radical by crocidolite increases with surface [Fe3+]. Arch Biochem Biophys 1992;298:646–650.[CrossRef][Medline]
  33. Ghio AJ, Carter JD, Richards JH, Crissman KM, Bobb HH, Yang F. Diminished injury in hypotransferrinemic mice after exposure to a metal-rich particle. Am J Physiol 2000;278:L1051–L1061.
  34. Rosenthal GJ, Germolec DR, Blazka ME, Corsini E, Simeonova P, Pollock P, Kong LY, Kwon J, Luster MI. Asbestos stimulates IL-8 production from human lung epithelial cells. J Immunol 1994;153:3237–3244.[Abstract]
  35. Simeonova PP, Luster MI. Asbestos induction of nuclear transcription factors and interleukin 8 gene regulation. Am J Respir Cell Mol Biol 1996;15:787–795.[Abstract]
  36. Landsberg E-Ch. Organic acid synthesis and release of hydrogen ions in response to Fe deficiency stress of mono- and dicotyledonous plant species. J Plant Nutr 1981;3:579–591.
  37. Van Duijn MM, Van der Zee J, VanSteveninck J, Van den Broek PJA. Ascorbate stimulates ferricyanide reduction in HL-60 cells through a mechanism distinct from the NADH-dependent plasma membrane reductase. J Biol Chem 1998;273:13415–13420.[Abstract/Free Full Text]
  38. Raja KB, Bjarnason IT, Simpson RJ, Peters TJ. In vitro measurement and adaptive response of Fe3+ uptake by mouse intestine. Cell Biochem Funct 1987;5:69–76.[CrossRef][Medline]
  39. Guilianelli C, Baeza-Squiban A, Boisvieux-Ulrich E, Houcine O, Zalma R, Guennou C, Pezerat H, Marano F. Effect of mineral particles containing iron on primary cultures of rabbit tracheal epithelial cells: possible implication of oxidative stress. Environ Health Perspect 1993;101:436–442.[Medline]
  40. Leibold EA, Munro HN. Cytoplasmic protein binds in vitro to a highly conserved sequence in the 5' untranslated region of ferritin heavy- and light-subunit mRNAs. Proc Natl Acad Sci USA 1988;85:2171–2175.[Abstract/Free Full Text]
  41. Haile DJ, Rouault TA, Harford JB, Kennedy MC, Blondin GA, Beinert H, Klausner RD. Cellular regulation of the iron-responsive element binding protein: disassembly of the cubane iron-sulfur cluster results in high-affinity RNA binding. Proc Natl Acad Sci USA 1992;89:11735–11739.[Abstract/Free Full Text]
  42. Offer T, Russo A, Samuni A. The pro-oxidative activity of SOD and nitroxide SOD mimics. FASEB J 2000;14:1215–1223.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-0275OCv1
34/3/286    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, X.
Right arrow Articles by Ghio, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, X.
Right arrow Articles by Ghio, A. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2006 American Thoracic Society.