help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published ahead of print on March 16, 2006, doi:10.1165/rcmb.2005-0259OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-0259OCv1
35/2/165    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baginski, T. K.
Right arrow Articles by Swinney, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baginski, T. K.
Right arrow Articles by Swinney, D. C.
American Journal of Respiratory Cell and Molecular Biology. Vol. 35, pp. 165-174, 2006
© 2006 American Thoracic Society
DOI: 10.1165/rcmb.2005-0259OC

Cigarette Smoke Synergistically Enhances Respiratory Mucin Induction by Proinflammatory Stimuli

Tomasz K. Baginski*, Karim Dabbagh, Chiradath Satjawatcharaphong and David C. Swinney

Roche Palo Alto, Palo Alto, California

Correspondence and requests for reprints should be addressed to David C. Swinney, Roche Palo Alto, 3431 Hillview Avenue, Palo Alto, CA 94304. E-mail: david.swinney{at}roche.com


    Abstract
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Pathogenic factors associated with chronic obstructive pulmonary disease (COPD), such as cigarette smoke, proinflammatory cytokines, and bacterial infections, can individually induce respiratory mucins in vitro and in vivo. Since co-presence of these factors is common in lungs of patients with COPD, we hypothesized that cigarette smoke can amplify mucin induction by bacterial exoproducts and proinflammatory cytokines, resulting in mucin hyperproduction. We demonstrated that cigarette smoke extract (CSE) synergistically increased gene expression and protein production of MUC5AC mucin induced by LPS or TNF-{alpha} in human airway epithelial NCI-H292 cells. CSE also enhanced expression and production of MUC5AC mucin induced by epidermal growth factor receptor (EGFR) ligands TGF-{alpha} and amphiregulin, as well as LPS- and TNF-{alpha}– induced expression and/or release of TGF-{alpha} and amphiregulin. Furthermore, (4-[(3-bromophenyl)amino]-6,7-diaminoquinazoline), a potent inhibitor of EGFR, blocked synergistic induction of MUC5AC mucin. H2O2 mimicked the synergistic effects of CSE, while antioxidant N-acetyl-L-cysteine prevented synergistic induction of MUC5AC mucin by CSE. In a rat model of LPS-induced airway inflammation, concurrent cigarette smoke inhalation enhanced mucin content of the bronchoalveolar lavage fluid, muc5AC gene expression, and mucous cell metaplasia in the airways. These results suggest that cigarette smoke has the potential to synergistically amplify induction of respiratory mucins by proinflammatory stimuli relevant to COPD pathogenesis and contribute to mucin hyperproduction observed in patients with COPD.

Key Words: mucin • COPD • oxidative stress • inflammation • respiratory


    Introduction
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Chronic obstructive pulmonary disease (COPD) is a disease characterized by a progressive, poorly reversible loss of lung function and abnormal inflammatory response of the lung to noxious gases and particles (1). Cigarette smoke has been considered a major etiologic factor in the pathogenesis of COPD. Cigarette smoke may contribute to the pathogenesis of COPD by increasing the sequestration of neutrophils (2), the burden of inflammatory cell–derived oxidants (3), and by causing an inactivation of protease inhibitors (4, 5). Cigarette smoke can also induce airway inflammation. It has been shown to activate proinflammatory transcription factors NF-{kappa}B and activator protein (AP)-1 (68) as well as to upregulate the expression of TNF-{alpha} and IL-8, proinflammatory mediators associated with COPD (9, 10). Interestingly, it has been suggested that in COPD cigarette smoke may contribute to the uncontrollable nature of COPD through the amplification of normal inflammatory response in the airways (11).

Respiratory mucins protect the airway epithelium against exogenous insults, and their hyperproduction is evoked by a variety of proinflammatory stimuli (12) as a part of the inflammatory response in airways. In chronic airway diseases such as COPD, mucin hyperproduction contributes to airway obstruction (13), accelerated decline of lung function (13, 14), morbidity (13), and mortality (15, 16). Stimuli relevant to the pathogenesis of COPD, such as cigarette smoke and its components (17, 18), oxidative stress (19), bacterial exoproducts (20, 21), and proinflammatory cytokines (TNF-{alpha} and IL-1beta) (22, 23) have been shown to induce the expression and production of respiratory mucins in vitro and in vivo. A potential cooperation between them, although pathologically relevant, has remained so far unexplored.

In this study, we hypothesized that cigarette smoke can synergistically amplify respiratory mucin gene expression and protein production induced by bacterial exoproducts and proinflammatory cytokines relevant to the pathogenesis of COPD. We demonstrated here for the first time that in human airway epithelial NCI-H292 cells, cigarette smoke extract, which is commonly used to mimic effects of cigarette smoke, synergistically increased the induction of respiratory mucin MUC5AC by LPS and TNF-{alpha}, both at the level of gene expression and protein production. The observed synergy was dependent on the activation of epidermal growth factor receptor (EGFR) and induction of EGFR ligands, as well as the presence of oxidative stress. To examine the relevance of our in vitro results, we evaluated in vivo the effects of concurrent cigarette smoke inhalation on LPS-induced mucin response in rat airways. We showed that cigarette smoke synergistically enhanced LPS-induced total mucin content of BALF, muc5AC mucin gene expression, and goblet cell metaplasia in the airways. Altogether, our study demonstrated that cigarette smoke can synergistically enhance, in vitro and in vivo, respiratory mucin induction by proinflammatory stimuli relevant to the pathogenesis of COPD, which may constitute an amplification step contributing to the exacerbated mucin production observed in stable COPD and COPD exacerbations.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Pseudomonas aeruginosa lipopolysaccharide serotype 10 (Sigma, St. Louis, MO); Staphylococcus aureus lipoteichoic acid (Sigma); TNF-{alpha}, IL-1beta, IL-4, IL-13, TGF-{alpha}, amphiregulin (AR; R&D Systems, Minneapolis, MN); H2O2, N-acetyl-L-cysteine (Sigma); 4-[(3-bromophenyl)amino]-6,7-diaminoquinazoline (BPDQ) (Calbiochem, San Diego, CA); biotinylated mouse anti-human MUC5AC antibody/clone 45M1 (Labvision, Fremont, CA).

Preparation of Cigarette Smoke Extract
Aqueous cigarette smoke extract (CSE) was used to mimic the effects of cigarette smoke in vitro. Cigarette smoke of Research Cigarettes 1R1 (University of Kentucky) was slowly bubbled through the Phenol Red–free RPMI 1640 medium containing 10 mM HEPES (30 of 30 ml puffs/60 ml of medium), and CSE was frozen in aliquots and stored at –80°C. An aliquot of cigarette smoke–conditioned medium was thawed immediately before use.

Cell Culture
NCI-H292 human pulmonary mucoepidermoid cells (ATCC# CRL-1848) were maintained in RPMI 1640 medium supplemented with 10% FBS, penicillin, and streptomycin (100 U/ml each), at 37°C in a humidified 5% CO2 atmosphere. Cells were grown till confluence in 48-well plates (Falcon, Franklin Lakes, NJ), and before stimulation cells were maintained overnight in the low-serum medium (LS medium: Phenol Red–free RPMI 1640/0.05% FBS/penicillin/streptomycin). Upon 24 h stimulation, samples of a cell-conditioned medium were collected upon brief centrifugation and stored frozen in sealed 96-well polypropylene storage plates, at –80°C.

Cytotoxicity was determined in H292 cells that were grown to confluence in 96-well plates (Corning Costar, Acton, MA), and before stimulation the cells were maintained overnight in LS medium. BPDQ was added at concentrations between 0.1 nM and 1 uM, and the plates were incubated for 24 h. Effects of the compound on cell viability were assessed by the Cell Proliferation Kit II (Roche Applied Science, Indianapolis, IN), which quantitates the mitochondrial dehydrogenase activity of viable cells. H292 cell viability was > 90% at the highest dose of BPDQ used in the mucin quantitation experiments (100 nM), and > 85% at 1 µM BPDQ.

Animals, Treatment, Tissue, and Lavage Collection
The Roche Institutional Committee for the use and care of lab animals approved all animal experiments. Selected time-course of the study was based on the previous experiments in our laboratory and designed to avoid the maximal inflammatory responses. Female Han Wistar rats (~ 200 g) were exposed to air or to smoke of 24 cigarettes (1R1; University of Kentucky) per day, for four consecutive days (eight rats per exposure chamber). Twenty-four hours after the first exposure, rats were anesthetized by the inhalation of isoflurane. An aerosolizer intubation needle was inserted into the trachea and 250 µl of either Ringers solution or LPS (20 µg) were instilled into the trachea to form an aerosol. On Day 4, animals were killed with urethane (~ 1 g/kg, intraperitoneally). A tracheal cannula was inserted and lungs were lavaged with 3 x 3 ml of lavage fluid (PBS containing 0.1% BSA and 5 mM EDTA). Total leukocytes in the BAL fluid were determined using a Coulter Counter. Differential leukocyte counts were made on Cytospin (Shandon, Pittsburgh, PA) preparations stained with a modified Wright's stain (Diff-Quik; Dade-Behring, Newark, DE) by light microscopy using standard morphologic criteria. The remaining BAL fluid was centrifuged (3,000 rpm, 10 min) and the supernatants stored at –80°C. The left lobe of the lung was preserved in 10% formalin for histologic study. The right lobe of the lung, right bronchus, and trachea were preserved in the liquid nitrogen for mRNA analysis.

Real-Time Quantitative RT-PCR Analysis of Gene Expression
Total RNA from H292 cells and rat tissues was isolated using Qiagen (Valencia, CA) 96 RNeasy kit according to manufacturer's instructions. cDNA was prepared from total RNA using Taqman RT Reagents kit (Applied Biosystems, Foster City, CA) and expression levels of mRNA were measured by real-time quantitative RT-PCR (Taqman) using PE Applied Biosystems Prism 7700 Sequence Detector, according to manufacturer's instructions. Gene expression was normalized to 18S rRNA. The following Taqman primers and probes were used: 18S rRNA GATCCATTGGAGGGCAAGTCT (forward), 18S GCAGCAACTTTAATATACGCTATTGG (reverse), 18S probe FAM TGCCAGCAGCCGCGGTAATTC; human MUC5AC TACTCGCTCGAGGGCAACA (forward), human MUC5AC TGCAGTGCAGGGTCACATTC (reverse), human MUC5AC probe FAM CCAGGAGCTGCGGACCTCGC; human TGF-{alpha} CCTGGCTGTCCTTATCATCACA (forward), human TGF-{alpha} GGGCGCTGGGCTTCTC (reverse), human TGF-{alpha} probe-FAM ACACTGCTGCCAGGTCCGAAAACAC; human AR GTGGTGCTGTCGCTCTTGATAC (forward), human AR AGAGTAGGTGTCATTGAGGTCCAAT (reverse), human AR probe FAM CGGCTCAGGCCATTATGCTGCTG; rat TNF-{alpha} CCGGTTTGCCATTTCATACC (forward), rat TNF-{alpha} TCCTTAGGGCAAGGGCTCTT (reverse),rat TNF-{alpha} probe FAM AGAAAGTCAGCCTCCTCTCTGCCAT; ratmuc5AC GCCAATGCGGCACTTGTAC (forward), rat muc5AC CAGAACAAGAGGAGGCTATGGAA (reverse), rat MUC5AC probe FAM CAAAAAGGATGAATGCCGCCTGCC; rat KC CAATGAGCTGCGCTGTCAGT (forward), rat KC ACCTTCAAACTCTGGATGTTCTTGA (reverse), rat KC probe FAM TGAATCCCTGCCACTGTCTGCA.

Direct Enzyme-Linked Immunosorbent Assay of Cell Culture Medium Released MUC5AC Mucin
MUC5AC mucin in cell culture media was measured by means of direct enzyme-linked immunosorbent assay (ELISA) developed for this study. ELISA employed commercially available anti-MUC5AC biotinylated mouse monoclonal antibody 45M1 (Labvision), originally raised against a fraction of human gastric mucin M1, which has been subsequently shown to be encoded by MUC5AC gene (24). While the 45M1 antibody has been previously used in immunohistochemical studies and in ELISA experiments measuring mucins present in whole cell extracts, the reactivity of 45M1 with purified MUC5AC mucin from H292 cells or other sources has not been demonstrated. We verified that 45M1 antibody reacted with MUC5AC mucin purified from human sputum or isolated from human alveolar A549 cells. We also confirmed that mucin fraction isolated from H292 cells reacted with 45M1 antibody in antigen-capture assay employing affinity-purified rabbit polyclonal antibody LUM5-1, raised against a partial peptide sequence of human MUC5AC protein (25). In addition, we demonstrated that 45M1 antibody did not cross-react with MUC2 mucin isolated from human jejunum nor with MUC5B mucin isolated from human sputum. To assay MUC5AC mucin, samples of cell-conditioned medium were diluted ten times with distilled H2O, and 100 µl/well was dried overnight at 37°C in MaxiSorp microtiter plates (Nunc, Rochester, NY). Sample-coated wells were rehydrated with 100 µl of PBS for 10 min and washed three times with PBS. Next, wells were blocked with SuperBlock (Pierce, Rockford, IL) for 30 min, at room temperature and washed three times with PBS/0.05% Tween-20 (PBS-T). Incubation with biotinylated anti-MUC5AC antibody (diluted 1:1,000 in PBS-T) was performed for 1 h at room temperature. After five washes with PBS-T, incubation with streptavidin–peroxidase conjugate (diluted 1:1,000 in PBS-T; BD Pharmingen, Franklin Lakes, NJ) was performed for 30 min at room temperature. After five washes with PBS-T, a color reaction was developed with 100 µl of TMB substrate (BD Pharmingen) at room temperature. The reaction was terminated by addition of 50 µl of 1 M H3PO4 and absorbance was read at 450–570 nm. Arbitrary mucin units were used to reflect amount of MUC5AC mucin in samples and for calculation of the fold of induction.

Measurement of TGF-{alpha} and AR by ELISA
Human TGF-{alpha} Duo Set ELISA Development Set and human AR Duo Set ELISA Development Set (both from R&D Systems) were used according to manufacturer's instructions to measure soluble TGF-{alpha} and AR in the samples of cell culture medium.

Measurement of Mucin Content of Rat Bronchoalveolar Lavage Fluid by Enzyme-Linked Lectin Assay
Due to the lack of ELISA specific for the rat muc5AC mucin, total mucin content of rat bronchoalveolar lavage fluid was estimated by a double-sandwich, enzyme-linked lectin assay employing L-fucose-specific UEA-I lectin from Ulex europeus I (Sigma) (26).

Statistical Analysis
One-way ANOVA was used for normally distributed data to determine statistically significant differences between treatments. A probability of P < 0.05 was accepted as a statistically significant difference. All tests were performed using software GraphPad Prism 3.0 (GraphPad Software, San Diego, CA). Data are presented as a mean ± SEM.


    RESULTS
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
CSE Synergistically Enhances MUC5AC Mucin Production Induced by LPS or TNF-{alpha}
First, we examined at a single concentration, whether CSE can modulate the production of culture medium–released MUC5AC mucin in NCI-H292 cells induced by selected exoproducts of gram-negative and gram-positive bacteria as well as selected cytokines (Figure 1A). Twenty-four hours of stimulation with CSE (1%), LPS (10 µg/ml), lipoteichoic acid (LTA, 10 µg/ml), TNF-{alpha} (1 ng/ml), and IL-1beta (1 ng/ml) moderately induced MUC5AC mucin production (~ 2- to 3-fold increase over control). A co-presence of CSE markedly augmented MUC5AC mucin production induced by LPS, LTA, and proinflammatory cytokines TNF-{alpha}, IL-1beta (respectively, ~ 4-fold, ~ 3-fold, ~ 5-fold, ~ 5-fold increase over the summed mucin production induced by separate stimuli). In contrast, an enhancement of mucin production was not observed for cytokines IL-4 (1 ng/ml) and IL-13 (1 ng/ml), and co-treatment with CSE and IL-4 appeared to decrease mucin production compared with CSE alone. Subsequent studies were focused on the modulation of LPS- and TNF-{alpha}–induced mucin induction by cigarette smoke. CSE alone (0.25–8%) induced MUC5AC mucin production in a dose-dependent manner (Figure 1B). LPS-induced MUC5AC mucin production was enhanced by CSE at concentrations of 0.25–2%, and partially decreased at higher concentrations of CSE (4–8%). TNF-{alpha}–induced MUC5AC mucin production was enhanced by CSE at concentrations 0.25–4%, and enhancement was lower at 8% CSE (Figure 1C). Next, we determined effects of 1% CSE on MUC5AC mucin production induced in a dose-dependent manner by LPS (0.62–10 µg/ml) or TNF-{alpha} (0.062–1 ng/ml) (Figures 1D and 1E). Co-stimulation with CSE and LPS or CSE and TNF-{alpha} resulted in a dose-dependent increase of MUC5AC mucin production with regards to LPS or TNF-{alpha} (Figures 1D and 1E). The increased levels of MUC5AC mucin production in these experiments were severalfold higher than the additive action of stimuli, leading us to conclude that CSE synergistically upregulates MUC5AC mucin production induced by LPS or TNF-{alpha}. A suppression and decreased enhancement of MUC5AC mucin production caused by co-stimulation with CSE at higher concentrations might be due to potential toxicity of combined high doses of stimuli.


Figure 1
View larger version (34K):
[in this window]
[in a new window]
 
Figure 1. (A) Effect of CSE (1%) on MUC5AC mucin production in NCI-H292 cells induced with: LPS (10 µg/ml), LTA (10 µg/ml), TNF-{alpha} (1 ng/ml), IL-1beta (1 ng/ml), IL-4 (1 ng/ml), and IL-13 (1 ng/ml). (B and C) Effect of CSE concentration on LPS- and TNF-{alpha}–induced MUC5AC mucin production in NCI-H292 cells. (D) Effect of LPS concentration on modulation of LPS-induced MUC5AC mucin production in NCI-H292 cells by CSE (1%). (E) Effect of TNF-{alpha} dose on modulation of TNF-{alpha}–induced MUC5AC mucin production in NCI-H292 cells by CSE (1%). (F) Effect of CSE (1%) on LPS-induced IL-8 production in NCI-H292 cells. (G) Effect of CSE (1%) on TNF-{alpha}–induced IL-8 production in NCI-H292 cells. Production of cell culture medium-released MUC5AC mucin and release of IL-8 was measured at 24 h. Data represent an average of three independent experiments performed in triplicates (mean ± SEM).

 
Cigarette Smoke Synergistically Enhances IL-8 Production Induced by LPS or TNF-{alpha}
To determine whether the observed synergistic modulation by cigarette smoke was exclusive to MUC5AC mucin production, we measured under the same conditions the release of neutrophil chemoattractant IL-8 into the cell culture medium of H292 cells (Figures 1F and 1G). A concentration of 1% CSE did not induce IL-8 production, while at higher concentrations CSE was able to increase IL-8 in a dose-dependent manner (data not shown). IL-8 production was strongly induced by LPS (0.62–10 µg/ml) and moderately by TNF-{alpha} (0.062–1 ng/ml), also in a dose-dependent manner. Co-stimulation with CSE and LPS resulted only in a partial increase of IL-8 production (< 2-fold), while co-stimulation with CSE and TNF-{alpha} resulted in a strong synergistic increase of IL-8 production (~ 7.5-fold).

CSE Alters the Time-Course of MUC5AC Gene Expression Induced by LPS or TNF-{alpha}
A real-time quantitative RT-PCR showed that gene expression of MUC5AC mucin was moderately increased upon 24 h stimulation with CSE (1%), LPS (10 µg/ml), or TNF-{alpha} (1 ng/ml) (~ 3-fold, ~ 3-fold, and ~ 1.5-fold, respectively). Co-stimulation with CSE and LPS or CSE and TNF-{alpha} (Figures 2A and 2B) strongly increased MUC5AC expression (15-fold and 13-fold, respectively). A detailed examination of the time-course of MUC5AC expression revealed that upon treatment with CSE, LPS, or TNF-{alpha} alone, MUC5AC gene expression was maximal after 12 h and decreased at 24 h (Figures 2C and 2D). In contrast, co-stimulation with CSE and LPS or CSE and TNF-{alpha} caused a significant, time-dependent increase of MUC5AC expression up to 24 h (further time points were not investigated). Analysis of mRNA stability by a real-time quantitative RT-PCR demonstrated that CSE did not significantly alter stability of LPS- or TNF-{alpha}–induced MUC5AC mRNA (Figure 2E). We concluded that co-presence of CSE significantly increased and prolonged LPS- and TNF-{alpha}–induced MUC5AC mucin gene expression, without affecting rate of MUC5AC mRNA degradation.


Figure 2
View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. (A and B) Effect of CSE on LPS- and TNF-{alpha}–induced MUC5AC gene expression in NCI-H292 cells. Data represent an average of three independent experiments performed in triplicate (mean ± SEM). (C and D) Effect of CSE on the time-course of induction of MUC5AC gene expression in NCI-H292 cells by LPS and TNF-{alpha}. Data are representative of three independent experiments. Stimuli: CSE (1%), LPS (10 µg/ml), TNF-{alpha} (1 ng/ml). Cells were stimulated for the indicated period and relative expression of human MUC5AC mucin was measured by Taqman real-time quantitative RT-PCR in comparison to 18S rRNA. (E) Effect of CSE (1%) on stability of MUC5AC mRNA induced by LPS and TNF-{alpha}.in H292 cells. Data represent an average of two independent experiments performed in triplicate. Stimuli: CSE (1%), LPS (10 µg/ml), TNF-{alpha} (1 ng/ml). Cells were stimulated for 12 h and mRNA synthesis was inhibited by actinomycin D. Relative expression of human MUC5AC mucin was measured by Taqman real-time quantitative RT-PCR in comparison to 18S rRNA.

 
Activation of EGFR Is an Essential Step in Synergistic Modulation of MUC5AC Mucin Induction by CSE
LPS (21) and cigarette smoke (17, 18) induce MUC5AC mucin production through the ligand-dependent transactivation of EGFR in H292 cells. Therefore, we examined the importance of EGFR activation for synergistic induction of MUC5AC mucin production. Pretreatment of H292 cells for 1 h with BPDQ (10–10–10–7 M), a potent inhibitor of EGFR kinase (IC50 = 0.12 nM) (27), blocked synergistic production of MUC5AC mucin induced by CSE and LPS or CSE and TNF-{alpha} in a dose-dependent manner (Figures 3A and 3B). Next, we asked whether CSE can also modulate induction of MUC5AC mucin by EGFR ligands, TGF-{alpha}, or AR. Individually, TGF-{alpha} (12.5–200 pg/ml) and AR (0.125–2 ng/ml) induced MUC5AC mucin production in a dose-dependent manner, with TGF-{alpha} being a more potent stimulus (Figures 3C and 3D). Co-presence of CSE (1%) increased MUC5AC mucin production induced by either stimulus. The enhancement was observed primarily at the highest TGF-{alpha} concentration. We also examined whether CSE can modulate LPS- or TNF-{alpha}–induced gene expression and release of soluble TGF-{alpha} and AR at 24 h. CSE (1%) did not significantly increase gene expression of either ligand, while LPS and TNF-{alpha} increased expression only very modestly (Figures 3E and 3F). In contrast, co-stimulation with CSE and LPS or CSE and TNF-{alpha} strongly increased expression of TGF-{alpha} and AR (~ 3- to 5-fold increase over control). The soluble AR present in the cell culture medium at 24 h was moderately increased by CSE, LPS, or TNF-{alpha} (~ 2-fold over control), and co-stimulation with CSE and LPS or CSE and TNF-{alpha} increased AR levels ~ 7-fold and ~ 9-fold, respectively (Figures 3G and 3H). Under the same conditions, none of the treatments resulted in measurable amounts of soluble TGF-{alpha}. We conclude that CSE can also synergistically enhance production of MUC5AC mucin induced directly by EGFR ligands, TGF-{alpha}, and AR, as well as synergistically enhance LPS- or TNF-{alpha}–induced expression of TGF-{alpha} and AR, and release of soluble AR.


Figure 3
View larger version (40K):
[in this window]
[in a new window]
 
Figure 3. (A and B) Effect of inhibition of EGFR activation on the modulation of LPS- and TNF-{alpha}–induced MUC5AC mucin production in NCI-H292 cells by CSE. Before stimulation, cells were pre-incubated for 1 h with BPDQ. Stimuli: CSE (1%), LPS (10 µg/ml), TNF-{alpha} (1 ng/ml). (C and D) Effect of CSE (1%) on TGF-{alpha}– and AR-induced MUC5AC mucin production in NCI-H292 cells. (E and F) Effect of CSE (1%) on LPS- and TNF-{alpha}–induced gene expression and release of soluble TGF-{alpha} and AR in NCI-H292 cells. Production of cell culture medium-released MUC5AC mucin, TGF-{alpha}, and AR was measured at 24 h. Relative expression of human TGF-{alpha} and AR was measured by Taqman real-time quantitative RT-PCR in comparison to 18S rRNA. Data represent an average of three independent experiments performed in triplicate (mean ± SEM). n.d., not detected.

 
Antioxidants Block Synergistic Enhancement of MUC5AC Mucin Induction by CSE
Cigarette smoke is a potent source of oxidants, and oxidative stress has been shown to mediate induction of MUC5AC mucin production in H292 cells by cigarette smoke (17, 18). The importance of oxidative stress to LPS- or TNF-{alpha}–mediated mucin induction remains unknown. We examined the effect of N-acetyl-L-cysteine (NAC), an antioxidant and glutathione precursor, on synergistic induction of MUC5AC mucin production by CSE and LPS, as well as CSE and TNF-{alpha} to evaluate the role of oxidative stress in synergistic induction of MUC5AC production. One hour pretreatment of H292 cells with NAC (0.1–5 mM) inhibited synergistic increase of MUC5AC mucin production in a dose-dependent manner (Figures 4A and 4B). These results suggest that presence of oxidative stress is essential for synergistic modulation of MUC5AC mucin production by CSE.


Figure 4
View larger version (27K):
[in this window]
[in a new window]
 
Figure 4. (A and B) Effect of the antioxidant NAC on modulation of LPS- and TNF-{alpha}–induced MUC5AC mucin production in NCI-H292 cells by CSE. Before stimulation, cells were pre-incubated for 1 h with NAC. Stimuli: CSE (1%), LPS (10 µg/ml), TNF-{alpha} (1 ng/ml). (C and D) Effect of H2O2 (50 µM) on LPS- and TNF-{alpha}–induced MUC5AC mucin production in NCI-H292 cells. Production of cell culture medium-released MUC5AC mucin was measured at 24 h. Data represent an average of three independent experiments performed in triplicate (mean ± SEM).

 
Hydrogen Peroxide Mimics Synergistic Effects of Cigarette Smoke on MUC5AC Mucin Production Induced by LPS or TNF-{alpha}
Next, we examined whether addition of hydrogen peroxide can mimic synergistic effects of cigarette smoke on LPS- and TNF-{alpha}–induced MUC5AC mucin production. Fifty micromolars H2O2 moderately induced MUC5AC mucin production (2- to 3-fold). Co-stimulation with 50 µM H2O2 and LPS (0.62–5 µg/ml) resulted only in a partial enhancement of MUC5AC mucin production (< 2-fold), while this effect was not evident for LPS at 10 µg/ml (Figure 4C). H2O2 and TNF-{alpha} strongly induced MUC5AC mucin production, in a dose-dependent and synergistic manner (Figure 4D). We concluded that H2O2-induced oxidative stress can mimic synergistic effects of cigarette smoke on TNF-{alpha}–induced MUC5AC mucin production and partially on LPS-induced MUC5AC mucin production.

Cigarette Smoke Synergistically Enhances Mucin Induction in a Rat Model of LPS-Induced Airway Inflammation
To test the relevance of our findings from H292 cells, we examined whether cigarette smoke can also synergistically enhance production of respiratory mucins in vivo, in a rat model of LPS-induced airway inflammation. Animals were subjected to either cigarette smoke inhalation for 4 d, a single intratracheal instillation of LPS, or a combination of both treatments, and gene expression of rat muc5AC mucin (rmuc5AC) in the airways and lung was determined by real-time quantitative RT-PCR. Expression of rmuc5AC in the trachea/bronchus and in the lung of animals exposed to smoke or LPS did not significantly differ from the control animals (exposed to air and intratracheal instillation of saline) (Figures 5A and 5B). In the animals co-exposed to cigarette smoke and LPS, expression of rmuc5AC in the trachea/bronchus and in the lung was strongly increased compared with all other treatments (~ 30-fold by comparison of mean versus control). This increase of rmuc5AC gene expression was accompanied by an increase of the total mucin content of bronchoalveolar lavage fluid (BALF), measured by the enzyme-linked lectin assay (Figure 5C). The mucin content of BALF was ~ 4.5-fold higher in the animals co-exposed to cigarette smoke and LPS than in the control animals. In comparison, LPS treatment increased mucin content ~ 1.8 times, whereas cigarette smoke treatment did not increase the mucin content of BALF. We concluded that in an LPS-induced rat model of airway inflammation, inhalation of cigarette smoke synergistically increased rmuc5AC mucin gene expression and total mucin content of the BALF.


Figure 5
View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. Effect of cigarette smoke inhalation on LPS-induced gene expression of rat muc5AC in the trachea/bronchus (A) and in the lung (B). Relative expression of muc5AC was measured in triplicates by Taqman real-time quantitative RT-PCR in comparison to 18S rRNA. Data represent mean ± SEM. Control, n = 4; other treatments, n = 6. (C) Effect of cigarette smoke inhalation on the amount of LPS-induced mucins in the bronchoalveolar lavage fluid. Total mucin content was measured using enzyme-linked lectin assay. Animals were subjected to cigarette smoke for 4 d (24 cigarettes/d), intratracheal instillation of LPS (20 µg) on the second day, or combination of both treatments. Control animals were exposed to air and intratracheal instillation of PBS. Results are shown for 96 h. ns, nonsignificant compared with control.

 
Cigarette Smoke Enhances LPS-Induced Mucous-Cell Metaplasia in Airways
Alcian Blue/periodic acid Schiff (AB/PAS) staining of goblet cells for mucous glycoconjugates was performed to evaluate effects of cigarette smoke on LPS-induced mucous-cell metaplasia. Airways of the control animals showed very weak or no AB/PAS staining (Figure 6A). Cigarette smoke treatment resulted in a sparse and weak staining in large and smaller airways (Figure 6B). In the LPS-treated animals, moderate AB/PAS staining was present both in the large and smaller airways (Figure 6C). On the other hand, a pronounced AB/PAS staining of goblet cells was evident in the large and smaller airways of animals co-exposed to cigarette smoke and LPS (Figure 6D). This indicated that inhalation of cigarette smoke enhanced LPS-induced goblet cell metaplasia both in the large and small airways.


Figure 6
View larger version (120K):
[in this window]
[in a new window]
 
Figure 6. Effect of cigarette smoke inhalation on LPS-induced mucous-cell metaplasia in the rat lung. Formaline-fixed lung sections were stained for mucus-containing goblet cells by AB-PAS staining. Animals were subjected to cigarette smoke for 4 d (24 cigarettes/d), intratracheal instillation of LPS (20 µg) on the second day, or combination of both treatments. Control animals were exposed to air and intratracheal instillation of PBS. Results are shown for 96 h. Arrows point to AB-PAS–stained goblet cells.

 
Inflammatory Responses in the Lung
We compared the gene expression of proinflammatory markers TNF-{alpha} and KC (a physiologic equivalent of human IL-8; also known as CINC1 or Gro1), as well as the recruitment of inflammatory cells to determine the effects of cigarette smoke on LPS-induced inflammatory responses in the lung. Expression of TNF-{alpha} did not differ among treatment groups (Figure 7A). Expression of KC was weakly increased only in smoke-treated animals and similar to the control values in LPS-treated animals and animals co-exposed to smoke and LPS (Figure 7B). Differential cell counts (Figure 7C) showed that the numbers of eosinophils or lymphocytes were not significantly increased by any treatment. Exposure to cigarette smoke or LPS caused a significant increase in number of neutrophils. Co-exposure to smoke and LPS also caused an increase in number of neutrophils. However, the difference was not statistically significant compared with smoke or with LPS alone. The recruitment of macrophages was strongly increased by exposure to LPS and co-exposure to smoke and LPS. Overall, we concluded that any synergistic increase in the recruitment of inflammatory cells into the BALF was not observed in animals co-exposed to smoke and LPS. A similar lack of synergy was observed in a separate experiment, at the earlier time point of 24 h after LPS (data not shown).


Figure 7
View larger version (18K):
[in this window]
[in a new window]
 
Figure 7. (A and B) Effect of cigarette smoke inhalation on LPS-induced gene expression of TNF-{alpha} and KC in the rat lung. Relative expression of TNF-{alpha} and KC was measured in triplicates by Taqman real-time quantitative RT-PCR in comparison to 18S rRNA. Data represent mean (± SEM). (C) Effect of cigarette smoke inhalation on LPS-induced recruitment of proinflammatory cells into bronchoalveolar lavage fluid. Differential cell count was performed as described in MATERIALS AND METHODS. TOT, total cell count; MAC, macrophages; EOS, eosinophils; NEU, neutrophils; LYM, lymphocytes. Data represent mean ± SEM. Control, n = 4; other treatments, n = 6. Animals were subjected to cigarette smoke for 4 d (24 cigarettes/d), intratracheal instillation of LPS (20 µg) on the second day, or combination of both treatments. Control animals were exposed to air and intratracheal instillation of PBS. Results are shown for 96 h.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
In this study, we examined the hypothesis that cigarette smoke can synergistically enhance gene expression and protein production of respiratory mucin MUC5AC induced by bacterial exoproducts or proinflammatory cytokines relevant to the pathogenesis of COPD.

We demonstrated for the first time that CSE synergistically amplified production of MUC5AC mucin selectively induced by exoproducts of gram-negative and gram-positive bacteria, as well as proinflammatory cytokines in human airway epithelial cells NCI-H292. Further, we showed that the enhancement of LPS- as well as TNF-{alpha}–induced MUC5AC mucin production was dependent on the concentration of CSE. Observed synergistic production of MUC5AC mucin appeared to result from sustained accumulation of MUC5AC mRNA caused by co-presence of CSE, suggesting an enhanced/or prolonged promoter activity or impaired mechanism(s) of resolution of MUC5AC gene expression.

Activation of EGFR pathway is a common denominator in the induction of MUC5AC mucin by various proinflammatory stimuli (17, 19, 21). EGFR ligands (TGF-{alpha} and AR) were proposed to mediate induction of MUC5AC mucin (21) and cell proliferation by cigarette smoke in H292 cells (28). We showed, using pharmacologic inhibition of EGFR, that activation of EGFR remains an essential step in the synergistic modulation of induced MUC5AC mucin production by CSE. We also showed that the synergistic modulation is associated with a prolonged increase in MUC5AC mRNA that is not due to increased stability of the mRNA. The prolonged mRNA expression could arise from prolonged activation of EGF receptor signaling or cross-talk between the signaling pathways. A number of potential mechanisms could contribute to the prolonged activation of the EGF receptor pathway. Ravid and coworkers found that hydrogen peroxide prolonged EGF receptor activation by failing to promote c-CBL–mediated downregulation (29). Release of EGF receptor ligands such as AR and TGF-{alpha} are stimulated by oxidants and TNF-{alpha}, resulting in signal amplification involving an autocrine feedback loop. Enhancement of induced production of IL-8 by cigarette smoke may also be mediated by similar mechanisms, since a ligand-dependent activation of EGFR has been shown for the IL-8 induction in H292 cells (10). Our data showing a synergistic effect on AR production are consistent with a role of autocrine amplication loop in the synergy; however, we do not have data to directly address a role for other potential contributing mechanisms.

Cigarette smoke is an extremely abundant source of oxidants (30), and CSE has been demonstrated to induce oxidative stress in H292 cells (28). MUC5AC induction by cigarette smoke is dependent, at least partially, on the presence of oxidative stress (17, 18), while the importance of oxidative stress in LPS- or TNF-{alpha}–mediated mucin induction remains unknown. In our study, CSE-dependent synergistic production of MUC5AC mucin was effectively blocked by antioxidant NAC, demonstrating that the presence of oxidative stress is essential for synergy to occur. The ability of an exogenous, oxidative stress (H2O2) to mimic synergistic effects of CSE indicates that cigarette smoke–induced oxidative stress is a contributing factor to synergy. While the underlying mechanisms of synergy are currently unclear, it is plausible that CSE acts at multiple levels to synergistically enhance induced mucin production. CSE-induced oxidative stress may act in a similar fashion, leading to the impairment of resolution of EGFR-dependent mucin induction. More importantly, CSE may also synergistically act downstream of EGFR signaling, at the level of regulation of transcription. There is increasing evidence that cigarette smoke and oxidative stress can adversely modulate process of histone acetylation/deacetylation (chromatin remodeling), thus prolonging activation of proinflammatory transcription factors and gene expression. Transcription factors NF-{kappa}B and AP-1 have been implicated in the mucin induction (20, 31), and oxidative stress and cigarette smoke have been shown to modulate chromatin remodeling and the activation of these proinflammatory transcription factors in vitro (3234). Recently, cigarette smoke has also been shown to alter chromatin remodeling, to activate NF-{kappa}B and AP-1, and to induce proinflammatory genes in vivo, in rat lungs (35). The mechanism of the observed synergy is yet to be elucidated; however, we do know that it involves the EGF receptor pathway and its ligands, is sensitive to oxidative stress, and results in prolonged activation of the muc5AC mRNA. Further studies are required to determine if the synergy primarily results from amplication of the EGF pathway or involves cross-talk between different signaling pathways that are sensitive to proinflammory cytokines and oxidative stress.

Since NCI-H292 cells are tumor-derived and might differ in responses from the cells in vivo, we also examined the effects of cigarette smoke on the induction of respiratory mucins in a rat model of LPS-induced airway inflammation. In our hands a selected course of cigarette smoke inhalation alone or LPS alone did not cause a statistically significant mucin response. However, LPS alone did increase the numbers of macrophages and neutrophils in the lungs. The low effect of LPS alone on mucus production is mainly due to the fact that we chose a low dose of LPS which was used to induce a suboptimal mucus response to better obtain potential synergistic effect with CS. Consistent with our cellular studies, cigarette smoke inhalation strongly enhanced LPS-induced gene expression of rmuc5AC mucin in the airways, total mucus content of the BALF, and mucous-cell metaplasia. While this amplification of mucin response may have resulted from the augmented action of proinflammatory mediators and inflammatory cells, at the investigated time-point there was not any evidence of synergistic increase of selected markers of inflammation in the airways. In rats, a cigarette smoke–induced airway inflammation has been reported to be dependent on the oxidative stress (36). While we did not measure the markers of oxidative stressing in our model, it is possible that cigarette smoke–induced oxidative stress is responsible for or contributes to the synergistic modulation of LPS-induced mucin response. This would appear to be in agreement with the findings that ozone, a powerful source of oxidative stress, also enhanced induction of respiratory mucins and mucous-cell metaplasia by LPS in the rat airways (37). Altogether, our findings appear to be highly relevant to the pathogenesis of COPD, since they demonstrate that in vivo, the levels of cigarette smoke insufficient to evoke mucin response, can synergistically amplify mucin response induced by other proinflammatory stimuli. Such amplification of mucin response by cigarette smoke on the background of inflammation appears to resemble one of the components of COPD exacerbations in humans, and our rat model of co-exposure to cigarette smoke and LPS could serve as a valuable animal model of COPD-like exacerbation.

Airway inflammation in patients with COPD is characterized by the concomitant presence of multiple proinflammatory mediators and associated with increased levels of TNF-{alpha}, presence of oxidative stress (3, 3840), and frequently presence of bacterial exoproducts due to infections (41, 42). Since cigarette smoke is a main factor in the pathogenesis of COPD, we hypothesize that concomitant presence of cigarette smoke/or cigarette smoke–induced oxidative stress and inflammation in the airways might result in a synergistic enhancement of mucin hyperproduction induced by proinflammatory cytokines and bacterial exoproducts. This might constitute an amplification step contributing to the severity and persistence of mucin hyperproduction as seen in stable COPD and in COPD exacerbations. A potential contribution of such synergistic modulation might depend on the relative depletion of "oxidative reserve" (defined here as capacity of the cells to cope with the oxidative stress and its chronic effects), which in turn would be influenced by a length and degree of exposure to cigarette smoke, as well as by the genetic background of antioxidant genes (43). Therapies targeting oxidative stress may prove to be useful in the treatment of COPD-associated pathologic mucin hyperproduction.


    Acknowledgments
 
T.K.B. acknowledges Pamela Olson and Amy Berson of Roche Palo Alto for the introduction to Taqman quantitative RT-PCR methodology. The authors also thank Dr. Mary Mulkins for conducting the cytotoxicity assays.


    Footnotes
 
* Current affiliation: Prozyme Inc., San Leandro, California Back

Originally Published in Press as DOI: 10.1165/rcmb.2005-0259OC on March 16, 2006

Conflict of Interest Statement: T.K.B. was a full-time employee of Roche Palo Alto during the period in which this work was done. K.B. is a full-time employee of Roche Palo Alto. C.S. is a full-time employee of Roche Palo Alto. D.C.S. is a full-time employee of Roche Palo Alto.

Received in original form July 12, 2005

Accepted in final form February 14, 2006


    References
 Top
 Abstract
 Introduction
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 

  1. Pauwels RA, Buist AS, Calverley PM, Jenkins CR, Hurd SS. Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease. NHLBI/WHO Global Initiative for Chronic Obstructive Lung Disease (GOLD) Workshop summary. Am J Respir Crit Care Med 2001;163:1256–1276.[Free Full Text]
  2. MacNee W, Wiggs B, Belzberg AS, Hogg JC. The effect of cigarette smoking on neutrophil kinetics in human lungs. N Engl J Med 1989;321:924–928.[Abstract]
  3. Rahman I, Morrison D, Donaldson K, MacNee W. Systemic oxidative stress in asthma, COPD, and smokers. Am J Respir Crit Care Med 1996;154:1055–1060.[Abstract]
  4. Carp H, Janoff A. Possible mechanisms of emphysema in smokers. In vitro suppression of serum elastase-inhibitory capacity by fresh cigarette smoke and its prevention by antioxidants. Am Rev Respir Dis 1978;118:617–621.[Medline]
  5. Carp H, Miller F, Hoidal JR, Janoff A. Potential mechanism of emphysema: alpha 1-proteinase inhibitor recovered from lungs of cigarette smokers contains oxidized methionine and has decreased elastase inhibitory capacity. Proc Natl Acad Sci USA 1982;79:2041–2045.[Abstract/Free Full Text]
  6. Anto RJ, Mukhopadhyay A, Shishodia S, Gairola CG, Aggarwal BB. Cigarette smoke condensate activates nuclear transcription factor-kappaB through phosphorylation and degradation of IkappaB(alpha): correlation with induction of cyclooxygenase-2. Carcinogenesis 2002;23:1511–1518.[Abstract/Free Full Text]
  7. Nishikawa M, Kakemizu N, Ito T, Kudo M, Kaneko T, Suzuki M, Udaka N, Ikeda H, Okubo T. Superoxide mediates cigarette smoke-induced infiltration of neutrophils into the airways through nuclear factor-kappaB activation and IL-8 mRNA expression in guinea pigs in vivo. Am J Respir Cell Mol Biol 1999;20:189–198.[Abstract/Free Full Text]
  8. Rahman I, Smith CA, Lawson MF, Harrison DJ, MacNee W. Induction of gamma-glutamylcysteine synthetase by cigarette smoke is associated with AP-1 in human alveolar epithelial cells. FEBS Lett 1996;396:21–25.[CrossRef][Medline]
  9. Hellermann GR, Nagy SB, Kong X, Lockey RF, Mohapatra SS. Mechanism of cigarette smoke condensate-induced acute inflammatory response in human bronchial epithelial cells. Respir Res 2002;3:22.[CrossRef][Medline]
  10. Richter A, O'Donnell RA, Powell RM, Sanders MW, Holgate ST, Djukanovic R, Davies DE. Autocrine ligands for the epidermal growth factor receptor mediate interleukin-8 release from bronchial epithelial cells in response to cigarette smoke. Am J Respir Cell Mol Biol 2002;27:85–90.[Abstract/Free Full Text]
  11. Barnes PJ, Shapiro SD, Pauwels RA. Chronic obstructive pulmonary disease: molecular and cellular mechanisms. Eur Respir J 2003;22:672–688.[Abstract/Free Full Text]
  12. Van Seuningen I, Pigny P, Perrais M, Porchet N, Aubert JP. Transcriptional regulation of the 11p15 mucin genes. Towards new biological tools in human therapy, in inflammatory diseases and cancer? Front Biosci 2001;6:D1216–D1234.[Medline]
  13. Vestbo J, Prescott E, Lange P. Association of chronic mucus hypersecretion with FEV1 decline and chronic obstructive pulmonary disease morbidity. Copenhagen City Heart Study Group. Am J Respir Crit Care Med 1996;153:1530–1535.[Abstract]
  14. Vestbo J. Epidemiological studies in mucus hypersecretion. Novartis Found Symp 2002;248:3–12.[Medline]
  15. Speizer FE, Fay ME, Dockery DW, Ferris BG Jr. Chronic obstructive pulmonary disease mortality in six US cities. Am Rev Respir Dis 1989;140:S49–S55.[Medline]
  16. Lange P, Nyboe J, Appleyard M, Jensen G, Schnohr P. Relation of ventilatory impairment and of chronic mucus hypersecretion to mortality from obstructive lung disease and from all causes. Thorax 1990;45:579–585.[Abstract]
  17. Takeyama K, Jung B, Shim JJ, Burgel PR, Dao-Pick T, Ueki IF, Protin U, Kroschel P, Nadel JA. Activation of epidermal growth factor receptors is responsible for mucin synthesis induced by cigarette smoke. Am J Physiol Lung Cell Mol Physiol 2001;280:L165–L172.[Abstract/Free Full Text]
  18. Shao MX, Nakanaga T, Nadel JA. Cigarette smoke induces MUC5AC mucin overproduction via tumor necrosis factor-{alpha} converting enzyme in human airway epithelial (NCI-H292) cells. Am J Physiol Lung Cell Mol Physiol 2004;287:L420–L427.[Abstract/Free Full Text]
  19. Takeyama K, Dabbagh K, Jeong SJ, Dao-Pick T, Ueki IF, Nadel JA. Oxidative stress causes mucin synthesis via transactivation of epidermal growth factor receptor: role of neutrophils. J Immunol 2000;164:1546–1552.[Abstract/Free Full Text]
  20. Li JD, Feng W, Gallup M, Kim JH, Gum J, Kim Y, Basbaum C. Activation of NF-kappaB via a Src-dependent Ras-MAPK-pp90rsk pathway is required for Pseudomonas aeruginosa-induced mucin overproduction in epithelial cells. Proc Natl Acad Sci USA 1998;95:5718–5723.[Abstract/Free Full Text]
  21. Shao MX, Ueki IF, Nadel JA. Tumor necrosis factor alpha-converting enzyme mediates MUC5AC mucin expression in cultured human airway epithelial cells. Proc Natl Acad Sci USA 2003;100:11618–11623.[Abstract/Free Full Text]
  22. Perrais M, Pigny P, Copin MC, Aubert JP, Van Seuningen I. Induction of MUC2 and MUC5AC mucins by factors of the epidermal growth factor (EGF) family is mediated by EGF receptor/Ras/Raf/extracellular signal-regulated kinase cascade and Sp1. J Biol Chem 2002;277:32258–32267.[Abstract/Free Full Text]
  23. Song KS, Lee WJ, Chung KC, Koo JS, Yang EJ, Choi JY, Yoon JH. Interleukin-1 beta and tumor necrosis factor-alpha induce MUC5AC overexpression through a mechanism involving ERK/p38 mitogen-activated protein kinases-MSK1-CREB activation in human airway epithelial cells. J Biol Chem 2003;278:23243–23250.[Abstract/Free Full Text]
  24. Bara J, Chastre E, Mahiou J, Singh RL, Forgue-Lafitte ME, Hollande E, Godeau F. Gastric M1 mucin, an early oncofetal marker of colon carcinogenesis, is encoded by the MUC5AC gene. Int J Cancer 1998;75:767–773.[CrossRef][Medline]
  25. Hovenberg HW, Davies JR, Carlstedt I. Different mucins are produced by the surface epithelium and the submucosa in human trachea: identification of MUC5AC as a major mucin from the goblet cells. Biochem J 1996;318:319–324.
  26. Jackson A, Kemp P, Giddings J, Sugar R. Development and validation of a lectin-based assay for the quantitation of rat respiratory mucin. Novartis Found Symp 2002;248:94–105.[Medline]
  27. Rewcastle GW, Palmer BD, Bridges AJ, Showalter HD, Sun L, Nelson J, McMichael A, Kraker AJ, Fry DW, Denny WA. Tyrosine kinase inhibitors. 9. Synthesis and evaluation of fused tricyclic quinazoline analogues as ATP site inhibitors of the tyrosine kinase activity of the epidermal growth factor receptor. J Med Chem 1996;39:918–928.[CrossRef][Medline]
  28. Lemjabbar H, Li D, Gallup M, Sidhu S, Drori E, Basbaum C. Tobacco smoke-induced lung cell proliferation mediated by tumor necrosis factor alpha-converting enzyme and amphiregulin. J Biol Chem 2003;278:26202–26207.[Abstract/Free Full Text]
  29. Ravid T, Sweeney C, Gee P, Carraway KL III, Goldkorn T. Epidermal growth factor receptor activation under oxidative stress fails to promote c-Cbl mediated down-regulation. J Biol Chem 2002;277:31214–31219.[Abstract/Free Full Text]
  30. Pryor WA, Stone K. Oxidants in cigarette smoke: radicals, hydrogen peroxide, peroxynitrate, and peroxynitrite. Ann N Y Acad Sci 1993;686:12–27.[Medline]
  31. Basbaum C, Li D, Gensch E, Gallup M, Lemjabbar H. Mechanisms by which gram-positive bacteria and tobacco smoke stimulate mucin induction through the epidermal growth factor receptor (EGFR). Novartis Found Symp 2002;248:171–176.[Medline]
  32. Janssen-Heininger YM, Macara I, Mossman BT. Cooperativity between oxidants and tumor necrosis factor in the activation of nuclear factor (NF)-kappaB: requirement of Ras/mitogen-activated protein kinases in the activation of NF-kappaB by oxidants. Am J Respir Cell Mol Biol 1999;20:942–952.[Abstract/Free Full Text]
  33. Allen GL, Menendez IY, Ryan MA, Mazor RL, Wispe JR, Fiedler MA, Wong HR. Hyperoxia synergistically increases TNF-alpha-induced interleukin-8 gene expression in A549 cells. Am J Physiol Lung Cell Mol Physiol 2000;278:L253–L260.[Abstract/Free Full Text]
  34. Tanaka C, Kamata H, Takeshita H, Yagisawa H, Hirata H. Redox regulation of lipopolysaccharide (LPS)-induced interleukin-8 (IL-8) gene expression mediated by NF kappa B and AP-1 in human astrocytoma U373 cells. Biochem Biophys Res Commun 1997;232:568–573.[CrossRef][Medline]
  35. Marwick JA, Kirkham PA, Stevenson CS, Danahay H, Giddings J, Butler K, Donaldson K, MacNee W, Rahman I. Cigarette smoke alters chromatin remodeling and induces proinflammatory genes in rat lungs. Am J Respir Cell Mol Biol 2004;31:633–642.[Abstract/Free Full Text]
  36. Smith KR, Uyeminami DL, Kodavanti UP, Crapo JD, Chang LY, Pinkerton KE. Inhibition of tobacco smoke-induced lung inflammation by a catalytic antioxidant. Free Radic Biol Med 2002;33:1106–1114.[CrossRef][Medline]
  37. Wagner JG, Van Dyken SJ, Wierenga JR, Hotchkiss JA, Harkema JR. Ozone exposure enhances endotoxin-induced mucous cell metaplasia in rat pulmonary airways. Toxicol Sci 2003;74:437–446.[Abstract/Free Full Text]
  38. Rahman I, MacNee W. Oxidant/antioxidant imbalance in smokers and chronic obstructive pulmonary disease. Thorax 1996;51:348–350.[Medline]
  39. MacNee W. Oxidative stress and lung inflammation in airways disease. Eur J Pharmacol 2001;429:195–207.[CrossRef][Medline]
  40. Repine JE, Bast A, Lankhorst I, deBacker W, Dekhuijzen R, Demedts M, vanHerwaarden C, vanKlaveren R, Lammers JW, Larsson S, et al. Oxidative stress in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 1997;156:341–357.[Free Full Text]
  41. Monso E, Ruiz J, Rosell A, Manterola J, Fiz J, Morera J, Ausina V. Bacterial infection in chronic obstructive pulmonary disease: a study of stable and exacerbated outpatients using the protected specimen brush. Am J Respir Crit Care Med 1995;152:1316–1320.[Abstract]
  42. Soler N, Ewig S, Torres A, Filella X, Gonzalez J, Zaubet A. Airway inflammation and bronchial microbial patterns in patients with stable chronic obstructive pulmonary disease. Eur Respir J 1999;14:1015–1022.[Abstract]
  43. Molfino NA. Genetics of COPD. Chest 2004;125:1929–1940.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Eur Respir JHome page
P. D. N'Guessan, B. Temmesfeld-Wollbruck, J. Zahlten, J. Eitel, S. Zabel, B. Schmeck, B. Opitz, S. Hippenstiel, N. Suttorp, and H. Slevogt
Moraxella catarrhalis induces ERK- and NF-{kappa}B-dependent COX-2 and prostaglandin E2 in lung epithelium
Eur. Respir. J., September 1, 2007; 30(3): 443 - 451.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
T. Yoshida and R. M. Tuder
Pathobiology of Cigarette Smoke-Induced Chronic Obstructive Pulmonary Disease
Physiol Rev, July 1, 2007; 87(3): 1047 - 1082.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
T. J. Cawood, P. Moriarty, C. O'Farrelly, and D. O'Shea
Smoking and Thyroid-Associated Ophthalmopathy: A Novel Explanation of the Biological Link
J. Clin. Endocrinol. Metab., January 1, 2007; 92(1): 59 - 64.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-0259OCv1
35/2/165    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baginski, T. K.
Right arrow Articles by Swinney, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baginski, T. K.
Right arrow Articles by Swinney, D. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2006 American Thoracic Society.