Published ahead of print on May 18, 2006, doi:10.1165/rcmb.2005-0424OC
American Journal of Respiratory Cell and Molecular Biology. Vol. 35, pp. 444-456, 2006
© 2006 American Thoracic Society DOI: 10.1165/rcmb.2005-0424OC
Hypoxia-Induced Mitogenic Factor Promotes Vascular Adhesion Molecule-1 Expression via the PI-3K/AktNF- B Signaling Pathway
Qiangsong Tong,
Liduan Zheng,
Li Lin,
Bo Li,
Danming Wang and
Dechun Li
Department of Internal Medicine, Saint Louis University, St. Louis, Missouri; Department of Medicine, Johns Hopkins University, Baltimore, Maryland; and Department of Pathology, Union Hospital of Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei, China
Correspondence and requests for reprints should be addressed to Dechun Li, M.D., Ph.D., Department of Internal Medicine, Division of Pulmonary, Critical Care, and Sleep Medicine, Saint Louis University, 7th Floor, Desloge Towers, St. Louis, MO 63110-2539. E-mail: dli2{at}slu.edu
 |
Abstract
|
|---|
Hypoxia-induced mitogenic factor (HIMF), also known as FIZZ1 (found in inflammatory zone 1), is an important player in lung inflammation. However, the effects of HIMF on cell adhesion molecules involved in lung inflammation remain largely unknown. In the present work, we tested whether HIMF modulates vascular adhesion molecule (VCAM)-1 expression, and dissected the possible signaling pathways that link HIMF to VCAM-1 upregulation. Recombinant HIMF protein, instilled intratracheally into adult mouse lungs, results in a significant increase of VCAM-1 production in vascular endothelial, alveolar type II, and airway epithelial cells. In cultured mouse endothelial SVEC 4-10 and lung epithelial MLE-12 cells, we demonstrated that HIMF induces VCAM-1 expression via the phosphatidylinositol-3 kinase (PI-3K)/Aktnuclear factor (NF)- B signaling pathway. Knockdown of HIMF expression by small interference RNA attenuated LPS-induced VCAM-1 expression in vitro. We showed that HIMF induced phosphorylation of the I B kinase signalsome and, subsequently, I B , leading to activation of NF- B. Meanwhile, VCAM-1 production was correspondingly upregulated. Blocking NF- B signaling pathway by expression of dominant-negative mutants of I B kinase and I B suppressed HIMF-induced VCAM-1 upregulation. HIMF also strongly induced phosphorylation of Akt. A dominant-negative mutant of PI-3K, p85, as well as PI-3K inhibitor, LY294002, also blocked HIMF-induced NF- B activation and attenuated VCAM-1 production. Furthermore, LY294002 pretreatment abolished HIMF-enhanced mononuclear cells adhesion to endothelial and epithelial cells. Our findings connect HIMF to signaling pathways that regulate inflammation, and thus reveal the critical roles that HIMF plays in lung inflammation.
Key Words: gene expression hypoxia-induced mitogenic factor signal transduction vascular adhesion molecule-1
 |
Introduction
|
|---|
Leukocyte migration into the alveolar compartments is a prominent feature of acute and chronic lung inflammation (1), and the process involves several steps. The initial interaction between circulating leukocytes and endothelium appears to be transient, resulting in the rolling of leukocytes along the vessel wall (2). The rolling leukocytes then become activated by local factors generated by the endothelium, resulting in their arrest and firm adhesion to the vessel wall. Finally, the leukocyte transmigrates through the endothelium (2). These complex processes are regulated, in part, by specific endothelial-leukocyte adhesion molecules (3). One of primary importance is vascular adhesion molecule (VCAM)-1, a member of the immunoglobulin gene superfamily that mediates leukocyte binding to the endothelial cell through its interaction with the leukotyte's integrin counter-receptor very late activation antigen (VLA)-4 (4). Because of the selective expression of VLA-4 on monocytes and lymphocytes, but not neutrophils, VCAM-1 plays an important role in mediating mononuclear leukocyte-selective adhesion (5).
Cytokines commonly found in inflammatory atherogenic lesions, such as TNF- and IL-1, induce the concurrent expression of VCAM-1, intercellular adhesion molecule (ICAM)-1, and E-selectin in cultured endothelial cells (6). The elevated and prolonged expression of VCAM-1 has been observed in both experimental models and human inflammatory processes. Treatment of endothelial cells with bacterial LPS in vitro as well as administration of endotoxin in vivo upregulates VCAM-1 expression, especially in lung and liver (7, 8). Recent reports indicate that, during the lung inflammation process, alveolar epithelial cells are likely important not only for retention and activation of leukocytes, but also for regulating their passage into the airway (9). VCAM-1 upregulation via protein kinase C p38 kinaselinked cascade mediated the TNF- induced elevation of leukocyte adhesion and migration in the airway epithelium (9). Given the functional and clinical implications of these findings, efforts have been made to better understand the mechanism modulating VCAM-1 expression in endothelial and epithelial cells.
Previously, from a mouse model of hypoxia-induced pulmonary hypertension, we discovered a highly upregulated gene named hypoxia-induced mitogenic factor (HIMF) (10). HIMF shares homologies with FIZZ1 (found in inflammatory zone 1), a protein identified in a mouse lung inflammation model (11), and with resistin-like molecule- in adipose tissue (12). Holcomb and colleagues first reported FIZZ1 as an abundantly secreted protein in the bronchoalveolar lavage fluid of a murine asthmatic model (11). They observed the secretion of FIZZ1 from the inflamed airway epithelium and type 2 pneumocytes, and demonstrated that FIZZ1 could inhibit the action of nerve growth factor in vitro (11). During allergic pulmonary inflammation induced by ovalbumin challenge, FIZZ1 expression markedly increases in hypertrophic and hyperplasic bronchial epithelium, and also appears in alveolar type 2 cells (11). More recently, FIZZ1 has been implicated in mediating the deposition of extracellular matrix in an animal model of lung fibrosis (13). These studies suggest that FIZZ1 plays an important role in lung inflammation.
In the present study, we tested the hypothesis that HIMF is functioning in a cytokine-like manner, modulating VCAM-1 production. We investigated the molecular mechanisms of VCAM-1 upregulation mediated by HIMF in mouse lungs, cultured endothelial and lung epithelial cells, and dissected the possible signaling pathways. Our results connect HIMF-mediated signaling to the phosphatidylinositol-3 kinase (PI-3K)/Aktnuclear factor (NF)- B pathways, and reveal the critical role of HIMF in VCAM-1 production during lung inflammation.
 |
MATERIALS AND METHODS
|
|---|
Animal Experiments
All animal experiments followed the protocols approved by the Animal Care and Use Committee of Johns Hopkins University. Adult male C57BL/6 mice (1012 wk old) were obtained from Jackson Laboratories (Bar Harbor, ME). Recombinant HIMF protein was produced in TREx 293 cells and the secreted HIMF in the culture medium was purified with anti-FLAG chromatography, as previously described (10). The mock purification of the culture medium obtained from control TREx 293 cells was performed to exclude the role of possible contaminants (10). To examine the effects of HIMF on VCAM-1 production in vivo, recombinant HIMF protein or BSA (Sigma, St. Louis, MO) was intratracheally instilled into adult mouse lungs (200 ng/animal in 40 µl saline) via a 21-gauge catheter (14). The vehicle control animals were instilled with saline (40 µl/animal). The animals were killed by halothane overdose at the time points indicated in the figure legends, and the mouse lungs were either collected for immunohistochemical staining or frozen immediately in 80°C freezer for further molecular analyses.
Immunohistochemical Staining for VCAM-1
Lung samples were processed and immunostained as previously described (14). Briefly, the sections were incubated for 1 h with anti VCAM-1 antibodies (1:200 dilution; Santa Cruz Biotechnology, Inc., Santa Cruz, CA) followed by a 2-h incubation with goat anti-rabbit antibody conjugated with horseradish peroxidase (HRP) (1: 300 dilution; Bio-Rad, Hercules, CA). DAB substrate (Dako, Carpinteria, CA) was used to generate dark brown precipitate in the cells of the tissues. The sections were examined, and images were taken with a Sony color digital DXC-S500 camera (Sony Electronics, Oradell, NJ), using Image Pro-Express software (Media Cybernetics, Silver Spring, MD).
Western Blotting
Tissue collection, homogenization, and protein electrophoresis were performed as previously described (15). Cells were collected and proteins were extracted with 1x cell lysis buffer (20 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM -glycerophosphate, 1 mM Na3VO4, and 1 µg/ml leupeptin). Protein (50 µg) or 40 µl of medium supernatant (for HIMF expression assays of cultured cell lines) from each sample was subjected to 420% precast polyacrylamide gel (Bio-Rad) electrophoresis and transferred to nitrocellulose membranes (Bio-Rad). HIMF was detected with 1:1,000 dilution of the anti-HIMF antiserum (10). For VCAM-1 and GAPDH (Santa Cruz Biotechnology), the primary antibody dilutions were 1:500 and 1:1,000, respectively, and followed by 1:3,000 dilution of goat anti-rabbit HRP-labeled antibody (Bio-Rad). An ECL substrate kit (Amersham, Piscataway, NJ) was used for the chemiluminscent detection of the signals with autoradiography film (Amersham).
Semiquantitative RT-PCR for VCAM-1 and HIMF
To quantify gene transcripts of VCAM-1 and HIMF in cultured cell lines, total RNA was isolated with RNeasy Mini Kit (Qiagen Inc., Valencia, CA) as specified by the manufacturer. Reverse transcription reactions were conducted with Transcriptor First Strand cDNA Synthesis kit (Roche, Indianapolis, IN). The PCR primers used were the following: for mouse HIMF, 5'-ATGAAGACTACAACTTGTTCCC-3' (positions 104125 of second exon) and 5'-TTAG GACAGTTGG CAGCAGCG-3' (positions 419439 of fourth exon), amplifying a 336-bp fragment; for mouse VCAM-1, 5'-CCTCACTTGCAGCAC TACGGGCT-3' and 5'-TTTTCC AATATCCTCAATGACGGG-3', amplifying a 442-bp fragment between positions 189 and 630; for mouse GAPDH, 5'-GCCAAGGTCATCCATGACAACTTTGG-3' and 5'-GCCTGC TTCACCACCTTCTTGATGTC-3', amplifying a 314-bp fragment between positions 532 and 845. PCR bands were separated on ethidium bromidestained agarose gels. GAPDH was used to normalize the initial variations in sample concentration, and served as a control for reaction efficiency. The ratio between the amplified DNA fragments and GAPDH of each sample RNA was quantified by Phoretix 1 D software (Phoretix International Ltd., Newcastle upon Tyne, UK).
siRNA for HIMF Knockdown
Oligonucleotides encoding short RNAi hairpin sequences specific for HIMF or firefly luciferase were subcloned into pSuppressor (Imgenex, San Diego, CA). Annealed oligonucleotides were cloned downstream of U6 promoter (HIMF primer 1 sequence, 5'-TCGAACTATGAACAGATG GGCCTCCGAGTACTGGGAGGCCCATCTGTTCATAGTTTTTT-3'; HIMF primer 2 sequence, 5'-CTAGAAAAAACTATGAACAGATGG GCCTCCCAGTACTCGGAGGCCCA TCTGTTCATAGT-3'; firefly luciferase primer 1 sequence, 5'-TCGAACGGTGGCTCCCGCTGAAT TGGAGAGTACTGTCCAATTCAGCGGGAGCCACCGTTTTTT-3'; firefly luciferase primer 2 sequence, 5'-CTAGAAAAAACGGTGG CTCCCGCTGAATTGGACAGTACTCTCCAATTCAGCGGGAG CCACCGT). The constructs pSuppressor-HIMF and pSuppressor-LUC were verified by sequencing analysis.
Cell Culture and Stimulation with HIMF or LPS
SVEC 4-10, an SV40-transformed murine endothelial cell line, was obtained from the American Type Culture Collection (CRL-2181; ATCC, Manassas, VA) and grown in Dulbecco's modified Eagle's medium (DMEM; Gibco Laboratories, Grand Island, NY) containing 10% FBS (Life Technologies, Inc., Gaithersburg, MD), penicillin (100 U/ml), and streptomycin (100 µg/ml). Mouse lung epithelial cell line MLE-12 was cultured as previously described (16). Both cell lines were maintained at 37°C in a humidified atmosphere of 5% CO2. Confluent monolayers of SVEC 4-10 and MLE-12 were trypsinized, and 2 x 105 viable cells suspended in 2 ml of culture medium supplemented with 10% FBS were added to each well of 6-well plates. After the cell density reached 8090%, the cell culture medium was replaced with an equal volume of medium supplemented with 0.1% FBS and 2 mM L-glutamine. Thirty-three hours later, cells were incubated in either DMEM or RPMI 1640, serum-free, for 34 h at 37°C, pretreated with LY294002, SB203580, PD98059, or U0126 (Calbiochem, La Jolla, CA), as indicated, then stimulated with different concentrations of HIMF protein for various periods, with or without actinomycin D (5 µg/ml; Sigma, St. Louis, MO).
Transfection and Stable Cell Lines
HIMF cDNA vector, dominant-negative mutants of I B kinase (IKK) (IKK [K44A]), IKK (IKK [K44A]), I B super-repressor (I B [S32A/S36A]), and PI-3K dominant-negative mutant ( p85) were previously described (1618). HIMF cDNA, RNAi, or dominant-negative mutant vectors were transfected into SVEC 4-10 and MLE-12 cells with Lipofectamine 2000 (Life Technologies). Stable cell lines expressing HIMF, named SVEC-HIMF and MLE-HIMF, along with their transfection control (vector only) cells, SVEC-Zeo and MLE-Zeo, were established based on resistance to Zeocin (Invitrogen, 400 µg/ml). HIMF overexpression was validated by both Western blotting and RT-PCR analyses.
Dual-Luciferase Reporter Assay for VCAM-1 and NF- B
The mouse VCAM-1 promoter-luciferase reporter construct as well as sequential deletion within the 5'-flanking sequences, pGLVCAM-1 (3.7 luc), pGL-VCAM-1 (1.8 luc), pGLVCAM-1 (1.1 luc), pGLVCAM-1 (0.7 luc), and pGLVCAM-1 (0.3 luc) were kind gifts from Dr. Joji Ando (Department of Biomedical Engineering, Graduate School of Medicine, University of Tokyo, Tokyo, Japan) (19). The NF- B luciferase reporter construct pNF B-Luc, containing five tandem NF- B binding sites (TGGGGACTTTCCGC), was purchased from Stratagene (La Jolla, CA). After the cell density reached 8090%, cells were cotransfected with each luciferase reporter construct and renilla luciferase construct pRL-TK (Promega, Madison, WI), with or without HIMF protein stimulation. After culturing for specified periods of time, the cells were treated with passive lysis buffer according to the dual-luciferase assay manual (Promega), and luciferase activity was measured with a luminometer (Lumat LB9507; Berthold Technologies, Bad Wildbad, Germany). The firefly luciferase signal was normalized to the renilla luciferase signal for each individual well.
Phosphorylation Assay for IKK, I B , and Akt
SVEC 4-10 and MLE-12 cells were cultured in six-well plates with complete culture medium to 7080% confluence. The cell culture medium was replaced with either DMEM or RPMI 1640 supplemented with 0.1% FBS and 2 mM L-glutamine for 33 h, and then changed to serum-free medium for 34 h at 37°C. Finally, cells were pretreated with different signal transduction inhibitors for 1 h, and incubated with HIMF protein for different time periods, as indicated. Cells were then washed once with ice-cold PBS and extracted with cell lysis buffer. Lysates (50 µg) were subjected to 420% precast polyacrylamide gel (Bio-Rad) electrophoresis, transferred to nitrocellulose membranes (Bio-Rad), and probed with rabbit anti-mouse antibodies to phosphospecific and nonphosphorylated IKK, I B , and Akt (1:500 dilution; Santa Cruz Biotechnology), followed by 1:3,000 dilution of goat anti-rabbit HRP-labeled antibody (Bio-Rad). An ECL substrate kit (Amersham) was used for the chemiluminscent detection of the signals with autoradiography film (Amersham).
Cell Adherence Assay
For isolation of mononuclear cells, heparinized mouse blood was diluted with PBS, and 25 ml was immediately layered over 15 ml Ficoll-Paque (Amersham) and centrifuged (400 x g, 40 min, 22°C). The mixed mononuclear cell band was removed by aspiration, washed with PBS, and incubated for 2 h with anti-CD45 antibody (Santa Cruz Biotechnology), followed by a 1-h incubation with goat anti-rabbit antibody conjugated with fluorescein (1: 300 dilution; Vector Laboratories, Inc., Burlingame, CA). The labeled cells were counted and used in the adhesion assay. Confluent monolayers of SVEC 4-10 and MLE-12 were trypsinized, and 1 x 105 viable cells suspended in 1 ml of culture medium supplemented with 10% FBS were added to each well of the 12-well plates. After the cell density reached 8090%, the cell culture medium was replaced with an equal volume of medium supplemented with 0.1% FBS and 2 mM L-glutamine. Twenty-four hours later, cells were pretreated as indicated, and stimulated with HIMF protein for 24 h. Then, 1 x 105 mononuclear cells were added to each well, and the plates were incubated for 30 min at 37°C. The nonadherent mononuclear cells were removed by carefully washing the cells twice with medium. Finally, the number of adherent mononuclear cells was determined by counting five random high-power fields under a fluorescence microscope (Leitz Fluovert; Leitz, Rockleigh, NJ), and expressed as cell numbers/high-power field. For VCAM-1blocking studies, SVEC 4-10 and MLE-12 cells were preincubated with antiVCAM-1 antibody, control rabbit IgG or signal transduction inhibitors, respectively, for 30 min at 37°C with 5% CO2. SVEC 4-10 and MLE-12 cells were washed once with Hank's balanced salt solution without calcium and magnesium (HBSS, Life Technologies), and the mononuclear cells were added and incubated as described above.
Statistical Analysis
Unless otherwise stated, all data were shown as mean ± SEM. Statistical significance (P < 0.05) was determined by t test or ANOVA, followed by assessment of differences using SigmaStat 2.03 software (Jandel, Erkrath, Germany).
 |
RESULTS
|
|---|
HIMF Enhances VCAM-1 Expression in Mouse Lungs
To test the hypothesis that HIMF participates in regulation of VCAM-1 expression, we first tested whether administration of HIMF would enhance VCAM-1 expression in the lung. We instilled HIMF protein intratracheally into adult mouse lungs and performed immunohistochemical staining. As shown in Figure 1A, HIMF protein instillation resulted in a significant increase of VCAM-1 production in vascular endothelial, alveolar type II, and airway epithelial cells. In contrast, no significant VCAM-1 expression was observed in control mouse lungs treated with either saline or BSA. Western blotting experiments showed that, after intracheal instillation of HIMF for 6 h and 24 h, VCAM-1 expression was significantly enhanced in the lung tissues (Figure 1B). These results provide the first evidence that connect HIMF to VCAM-1 expression in mouse lungs.

View larger version (65K):
[in this window]
[in a new window]
|
Figure 1. HIMF enhances VCAM-1 expression in mouse lungs. Recombinant HIMF protein or BSA was intratracheally instilled into adult mouse lungs (200 ng/animal in 40 µl saline, n = 6). The vehicle controls were instilled with saline (40 µl/animal; n = 3). The mouse lungs were collected after 6 and 24 h. (A) Results of immunohistochemical staining indicated that instillation of HIMF protein, but not BSA, resulted in a significant increase of VCAM-1 production, mainly localized to alveolar type II and airway epithelial cells (right upper panel, arrows), and vascular endothelial cells (right lower panel, arrows). Scale bars: 100 µm. (B) Western blot with proteins from lung homogenates indicated that VCAM-1 production was enhanced in HIMF-instilled, but not in BSA- or saline-instilled mouse lungs. Asterisk indicates a significant increase compared with control mouse lungs instilled with saline only (P < 0.05).
|
|
Treatment of HIMF Increases VCAM-1 Expression in Mouse Endothelial and Lung Epithelial Cells
To investigate how HIMF modulates VCAM-1 expression, we examined the level of VCAM-1 protein and mRNA in HIMF-treated mouse endothelial and lung epithelial cell lines, SVEC 4-10 and MLE-12. As shown in Figure 2A, addition of recombinant HIMF into cell culture medium induced VCAM-1 protein production in both SVEC 4-10 and MLE-12 cells in an HIMF dosedependent manner. This result was also confirmed by RT-PCR (Figure 2B). Time-course studies showed that VCAM-1 production appeared at 6 h after administration of HIMF (40 nmol/liter), and was sustained until 24 h after administration (Figures 2C and 2D). To validate that HIMF enhances VCAM-1 expression, we established mouse endothelial and lung epithelial cell lines, SVEC-HIMF and MLE-HIMF, that stably express HIMF. As shown in Figures 3A and 3B, SVEC-HIMF and MLE-HIMF cells overexpressed HIMF mRNA and protein as compared with their parent and transfection controls. More importantly, the VCAM-1 mRNA and protein levels of SVEC-HIMF and MLE-HIMF were also increased significantly compared with those of their control counterparts (Figures 3A and 3B). These results clearly demonstrate that HIMF induces VCAM-1 production.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 2. HIMF induces VCAM-1 expression in mouse endothelial and lung epithelial cell lines. SVEC 4-10 and MLE-12 cells were starved with culture medium supplemented with 0.1% FBS and 2 mM L-glutamine. After 33 h, cells were treated with different concentrations of HIMF for various periods, as indicated. Western blot and semiquantitative RT-PCR were performed for VCAM-1 expression. Incubation of SVEC 4-10 and MLE-12 cells with 20, 40, and 80 nmol/liter of HIMF protein for 24 h resulted in increased VCAM-1 protein and mRNA levels in a dose-dependent manner (A and B). Time-course study indicated that HIMF (40 nmol/liter)-induced VCAM-1 production started at 6 h, and was sustained until 24 h (C and D). Triplicate experiments were performed with essentially identical results.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
Figure 3. HIMF overexpression in mouse endothelial and epithelial cell lines. SVEC 4-10 and MLE-12 cells were transfected by HIMF cDNA or control vector with Lipofectamine 2000. Stable cell lines, SVEC-HIMF and MLE-HIMF, along with their transfection control cells, SVEC-Zeo and MLE-Zeo, were selected based on resistance to Zeocin (400 µg/ml). Western blot (A) and RT-PCR (B) demonstrated that SVEC-HIMF and MLE-HIMF cells have increased HIMF protein and mRNA levels compared to their parent and transfection counterparts. Their VCAM-1 expression was also increased significantly compared with SEVC 4-10 and MLE-12 cells. Asterisk indicates a significant increase compared with parent controls (P < 0.05). Triplicate experiments were performed with essentially identical results.
|
|
Knockdown of HIMF Attenuated LPS-Induced VCAM-1 in Mouse Endothelial and Lung Epithelial Cells
LPS has been considered as the principal component in induction of VCAM-1 expression during lung inflammation. To further explore the role of HIMF in lung inflammation, we first performed knockdown of HIMF expression by RNA interference, then observed the changes in LPS-induced VCAM-1 upregulation in both endothelial and lung epithelial cells. As shown in Figures 4A and 4B, LPS induced extensive HIMF expression accompanied by upregulation of VCAM-1 in SVEC 4-10 and MLE-12 cells. When these cells were transfected with HIMF RNAi vector, the HIMF expression was abolished to a great extent. Moreover, knockdown of HIMF expression attenuated the LPS-induced VCAM-1 upregulation. However, transfection of cells with RNAi vector for firefly luciferase (nonfunctional control) or empty vector did not attenuate HIMF expression and LPS-induced VCAM-1 production, which indicates the specificity of the HIMF RNAi construct (Figures 4A and 4B). In view of the above findings that HIMF promotes VCAM-1 expression in vivo and in vitro, these results indicate that HIMF plays an important role in lung inflammation.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 4. Knockdown of HIMF attenuated LPS-induced VCAM-1 in mouse endothelial and lung epithelial cells. Confluent monolayers of SVEC 4-10 and MLE-12 were transfected with HIMF RNAi, LUC RNAi, or empty vectors, respectively. After 24 h, the cells were stimulated with different concentrations of LPS for various periods, as indicated. Western blot demonstrated that LPS induced intensive HIMF expression accompanied by upregulation of VCAM-1 in SVEC 4-10 (A) and MLE-12 (B) cells; however, transfection of cells with HIMF RNAi vector, but not LUC RNAi or empty vectors, abolished the HIMF expression to a great extent. Moreover, knockdown of HIMF expression attenuated the LPS-induced VCAM-1 upregulation. Triplicate experiments were performed with essentially identical results.
|
|
HIMF Enhances Transcription of VCAM-1 Rather than Its mRNA Stability
To understand how HIMF regulates VCAM-1 expression, we used a construct, pGLVCAM-1 (3.7 luc), that contains a VCAM-1 promoterdriven luciferase reporter gene. As shown in Figure 5A, incubation of pGLVCAM-1transfected SVEC 4-10 and MLE-12 cells with HIMF protein resulted in significant increases of transcripts of VCAM-1 promoterdriven luciferase in an HIMF dosedependent manner. Because modulation of mRNA stability has been reported as an important post-transcriptional mechanism that controls VCAM-1 gene expression (20), it is possible that HIMF enhances VCAM-1 expression by inducing factor(s) that contribute to VCAM-1 mRNA stability. To test this possibility, we examined the effects of HIMF on VCAM-1 mRNA stability by using a transcription inhibitor, actinomycin D. If HIMF affects the stability of VACM-1 mRNA, blocking transcription by actinomycin D should allow an observation of stabilized VCAM-1 mRNA in the cell. However, pretreatment of SVEC 4-10 and MLE-12 cells with HIMF protein and then actinomycin D did not prevent the existing VCAM-1 mRNA from degradation (Figures 5B and 5C), suggesting that HIMF enhances VCAM-1 expression in mouse endothelial and epithelial cells through increasing its transcription, rather than strengthening its mRNA stability.

View larger version (39K):
[in this window]
[in a new window]
|
Figure 5. HIMF increases the transcription rather than mRNA stability of VCAM-1 in SVEC 4-10 and MLE-12 cells. (A) SVEC 4-10 and MLE-12 cells were cotransfected with pGLVCAM-1 (3.7 luc) and pRL-TK. After 24 h, the cells were incubated with HIMF protein, as indicated. Cells were then lysed with passive lysis buffer, and luciferase activity was measured according to the dual-luciferase assay manual. The firefly luciferase signal was normalized to the renilla luciferase signal for each individual well. The time-course study showed that the transcription of VCAM-1 induced by HIMF (40 nmol/liter) started at 6 h and persisted until 24 h. After incubation with 1080 nmol/liter of HIMF for 24 h, transcription of VCAM-1 in SVEC 4-10 and MLE-12 cells was enhanced in a dose-dependent manner. (B and C) SVEC 4-10 and MLE-12 were treated with different concentrations of HIMF, and incubated with 5 µg/ml of actinomycin D for 4, 8, and 16 h. RT-PCR showed that HIMF did not prevent actinomycin Dfacilitated VCAM-1 messenger degradation in SVEC 4-10 and MLE-12 cells. Asterisks indicate a significant increase from SVEC 4-10 or MLE-12 controls untreated with HIMF (P < 0.05). Triplicate experiments were performed with essentially identical results.
|
|
Activation of NF- B Is Essential for HIMF-Induced VCAM-1 Production
To search for the putative transcription factor(s) involved in HIMF-induced VCAM-1 production, we used sequentially deleted 5'-flanking sequences of mouse VCAM-1 promoter (Figure 6A). The sequences TGGGTTTCCC at 73 bp and AGGGATTTCCC at 58 bp are identical to the consensus sequence (GGG R[C/A/T]TYYCC) of the NF- B binding site (19). The sequence TGACTCA at both 481 and 461 bp matches the AP-1 consensus sequence perfectly (19). A sequence (CGTCA) with homology to cAMP response element was also identified at position 1420 (19). As shown in Figure 5B, treatment of HIMF induces VCAM-1 promoterluciferase reporter activity significantly in transfected SVEC-HIMF and MLE-HIMF cells. The highest VCAM-1 luciferase activity was measured from a deletion construct pGLVCAM-1 (0.3 luc) that contains 2 NF- B binding sites within 329 bp of VCAM-1 promoter, whereas another deletion construct, pGLVCAM-1 (0.7 luc) exhibited lower luciferase activity (Figure 6B). Other VCAM-1 promoter deletions with sequences longer than pGLVCAM-1 (0.7 luc) showed a similar lower level of luciferase activity as pGLVCAM-1 (0.7 luc) (Figure 5B). These observations suggest that a negative regulatory element might exist between the 0.7 and 0.3 regions of the VCAM-1 promoter. It has been reported that NF- B regulates VCAM-1 expression (21). It is unknown, though, whether HIMF enhances VCAM-1 expression through NF- B pathway. To assess this possibility, we used NF- B luciferase reporter assay combined with transfection of several dominant-negative mutants in NF- B pathway, IKK (K44A), IKK (K44A), and I B (S32A/S36A) in SVEC 4-10 and MLE-12 cells. As shown in Figure 5C, NF- B activities in SVEC-HIMF and MLE-HIMF cells were significantly higher than those of their control counterparts, indicating HIMF-induced activation of NF- B in these cells. Furthermore, incubation of SVEC 4-10 and MLE-12 cells with HIMF protein resulted in an increase of NF- B activity in 6 h, and this increase was sustained until 24 h (Figure 7A). In response to HIMF, IKK was phosphorylated, which in turn phosphorylates I B , leading to NF- B activation in both SVEC 4-10 and MLE-12 cells (Figure 7B). In contrast, transfection of dominant-negative mutants IKK (K44A), IKK (K44A), and I B (S32A/ S36A) abolished HIMF-induced NF- B activation, leading to suppression of VCAM-1 transcription (Figure 7C) and protein expression (Figure 7D). Together, these results demonstrate that activation of transcription factor NF- B is essential for HIMF-induced VCAM-1 upregulation, and thus connected HIMF signaling to NF- B pathway.
PI-3K/Akt Pathway Is Involved in HIMF-Induced NF- B Activation and VCAM-1 Production
Our previous study showed that HIMF activates the PI-3K/Akt pathway in pulmonary microvascular smooth muscle cells (10). It is also known that PI-3K/Akt pathway participates in NF- B activation induced by cytokines (22, 23). Because HIMF, as an extracellular ligand, may function in a manner similar to a cytokine, we also tested whether PI-3K/Akt participates in HIMF-mediated NF- B activation. As shown in Figure 8A, HIMF strongly induced Akt phosphorylation at Ser473 and Thr308. The Akt activation was observed at 30 min of HIMF treatment, and the activation was sustained for 360 min. The PI-3K inhibitor, LY294002 (10 µmol/liter), inhibited HIMF-activated Akt phosphorylation (Figure 8B). However, incubation of cells with SB203580 (5 µmol/liter), PD098059 (5 µmol/liter), or U0126 (5 µmol/liter), inhibitors against p38 and ERK1/2 MAPK pathways, respectively, had no effect on HIMF-induced Akt phosphorylation (Figure 8B). In addition, transfection of p85, a dominant-negative mutant of PI-3K, into SVEC 4-10 and MLE-12 cells, abolished HIMF-induced phosphorylation of IKK and I B (Figure 8C), and the subsequent NF- B activation. These observation suggest that PI-3K/Akt pathway functions upstream of NF- B in responding to HIMF signals. Transfection of p85 also blocked HIMF-induced transcription of VCAM-1 (Figure 8D). Similarly, PI-3K inhibitor LY294002 specifically suppressed HIMF-induced VCAM-1 production in SVEC 4-10 and MLE-12 cells (Figure 8E). Together, these data suggest that the PI-3K/Akt pathway is involved in HIMF-mediated NF- B activation and the subsequent VCAM-1 production.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 8. PI-3K/Akt pathway is involved in HIMF-induced NF- B activation and VCAM-1 production. SVEC 4-10 and MLE-12 were pretreated with signal transduction inhibitors, or cotransfection of luciferase constructs and dominant-negative mutants, and stimulated with HIMF protein (20 nmol/liter) for various periods, as indicated. (A) HIMF strongly induced the phosphorylation of Akt at Ser473 and Thr308. The Akt activation (phosphorylation) started at 30 min and was sustained for 360 min. (B) PI-3K inhibitor, LY294002 (10 µmol/liter), abolished HIMF-induced Akt phosphorylation. However, SB203580 (5 µmol/liter), PD098059 (5 µmol/liter), or U0126 (5 µmol/liter) did not block HIMF-induced Akt phosphorylation at 180 min. (C) Transfection of p85, a dominant-negative mutant of PI-3K, into SVEC 4-10 and MLE-12 cells abolished HIMF-induced phosphorylation of IKK and I B at 180 min. (D) Transfection of p85 into SVEC 4-10 and MLE-12 cells also blocked HIMF-induced NF- B activation and VCAM-1 transcription activity at 24 h. (E) LY294002 (10 µmol/liter), but not SB203580 (5 µmol/liter), PD098059 (5 µmol/liter), or U0126 (5 µmol/liter), specifically suppressed HIMF-induced VCAM-1 production in SVEC 4-10 and MLE-12 cells at 24 h. Asterisks indicate a significant increase from SVEC 4-10 or MLE-12 controls treated without HIMF (P < 0.05). Pound symbols indicate a significant decrease from SVEC 4-10 or MLE-12 cells treated with HIMF only (P < 0.05). Triplicate experiments were performed with essentially identical results.
|
|
HIMF-Induced VCAM-1 Upregulation Promotes Adherence of Mononuclear Cells to SVEC 4-10 and MLE-12 Cells
One of the prominent functions of VCAM-1 is to mediate the adhesion of mononuclear cells by interaction with its counter-receptor, VLA4, and thus enhances inflammation (4, 5). To elucidate the effects exerted by HIMF-induced VCAM-1, we isolated the mononuclear cells from peripheral blood, and examined their adherence to HIMF-treated mouse endothelial and lung epithelial cells. HIMF stimulation resulted in an increase of adherence of mononuclear cell to SVEC 4-10 and MLE-12 cells (Figure 9A), and such adherence was blocked by antiVCAM-1 antibody. When SVEC 4-10 and MLE-12 cells were pretreated with PI-3K inhibitor LY294002 (10 µmol/liter) before HIMF incubation, the adherent mononuclear cells were significantly reduced (Figure 9B). In contrast, SB203580 (5 µmol/liter), PD098059 (5 µmol/liter), or U0126 (5 µmol/liter) did not abolish HIMF-induced mononuclear cell adherence to SVEC 4-10 and MLE-12 cells (Figure 9B). These results indicate that VCAM-1 upregulation induced by HIMF promotes the adherence of mononuclear cells to endothelial and lung epithelial cells, which is one of the most important events in lung inflammatory processes.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 9. HIMF-induced VCAM-1 upregulation promotes mononuclear cell adherence. Mononuclear cells were isolated from heparinized mouse blood using Ficoll-Paque, labeled with a fluorescein-labeled antibody against CD45, and incubated with SVEC 4-10 and MLE-12 cells for 30 min at 37°C in 5% CO2. The nonadherent cells were removed by carefully washing the cells twice with medium. The number of adherent mononuclear cells was determined by counting five random high-power fields. (A) Incubation of SVEC 4-10 and MLE-12 cells with HIMF (40 nmol/liter) protein for 24 h resulted in an increase of mononuclear cell adherence to them, which was blocked by antiVCAM-1 antibody, but not by rabbit IgG. (B) When SVEC 4-10 and MLE-12 cells were pretreated with PI-3K inhibitor, LY294002 (10 µmol/liter), 1 h before HIMF (40 nmol/liter) incubation, the number of adherent mononuclear cells was significantly decreased. However, SB203580 (5 µmol/liter), PD098059 (5 µmol/liter), or U0126 (5 µmol/liter) did not abolish HIMF-induced mononuclear cell adherence to SVEC 4-10 and MLE-12 cells. Asterisks indicate a significant increase from SVEC 4-10 or MLE-12 controls treated without HIMF (P < 0.05). Pound symbols indicate a significant decrease from SVEC 4-10 or MLE-12 cells treated with HIMF only (P < 0.05). Triplicate experiments were performed with essentially identical results.
|
|
 |
DISCUSSION
|
|---|
VCAM-1 was first identified as an adhesion molecule induced in endothelial cells by inflammatory cytokines IL-1 and TNF- , or by LPS (6, 7). In a murine model of ovalbumin-induced pulmonary inflammation, VCAM-1 was found to be prominently expressed on lung vascular tissues, which has important roles in antigen-induced recruitment of T cells and eosinophils (24). To date, there is only limited information available about the pattern and the signaling to VCAM-1 expression in alveolar epithelial cells. Cunningham and colleagues first investigated the expression of adhesion molecules VCAM-1, LFA-3, and B7 by alveolar epithelium (25). These molecules are not detected on the surface of isolated human type II pneumocytes (25). VCAM-1 is uniformly expressed on the vessels of the frozen sections of lung specimens, and was occasionally observed on the alveolar tissues (25). However, recent studies have demonstrated that constitutive VCAM-1 expression was enhanced by rhinovirus infection of alveolar epithelial cell lines (26). In addition, increased VCAM-1 expression has been noted on isolated human alveolar epithelial cells stimulated with TNF- (27). These results provide evidence of VCAM-1 expression in stimulated alveolar epithelial cells. In the present study, we found that HIMF induced VCAM-1 production in mouse lung tissues and cultured endothelial and alveolar epithelial cell lines through enhancing its transcription, but without affecting its mRNA stability. The process is dependent upon activated PI-3K/Akt and NF- B. These results suggest that HIMF may play critical roles in VCAM-1 production and lung inflammation via the PI-3K/AktNF- B pathways.
HIMF, also known as FIZZ1 in a lung allergic inflammation mouse model (11), belongs to a novel class of cysteine-rich secreted proteins known as resistin-like molecules (12). During allergic pulmonary inflammation, HIMF/FIZZ1 expression markedly increases in the bronchial mucosal epithelial cells, and it also appears in alveolar type II cells, but not in alveolar macrophages (11). The effects of HIMF/FIZZ1 on cell adhesion molecules involved in lung inflammation, however, remain largely unknown.
We have discovered that HIMF is upregulated in alveolar epithelial and endothelial cells during LPS-induced lung injury. Such injury is accompanied by extensive inflammatory cell sequestration in the lung parenchyma (data not shown). Because it is known that VCAM-1 enhances cell adhesion, we postulate that HIMF may modulate VCAM-1 expression. To obtain direct evidence for this hypothesis, we instilled HIMF protein intratracheally into adult mouse lungs (Figure 1). We found that VCAM-1 expression was significantly enhanced by HIMF stimulation in vascular endothelial, alveolar type II, and airway epithelial cells. These in vivo findings were confirmed in both HIMF-treated endothelial and lung epithelial cells (Figure 2), or lung cell lines that stably express HIMF (Figure 3). Furthermore, small interference (siRNA)-mediated knockdown of HIMF expression attenuated LPS-induced VCAM-1 expression in both endothelial and lung epithelial cells, indicating that HIMF plays a critical role in lung inflammation under normoxic conditions. However, our preliminary work indicates that hypoxia downregulates the VCAM-1 expression in both mouse endothelial and epithelial cells, and stable transfection of HIMF does not prevent hypoxia-mediated VCAM-1 decrease (data not shown). The mechanisms are unknown; however, it is conceivable to speculate that hypoxia-induced changes mediating VCAM-1 downregulation overcomes HIMF-induced VCAM-1 upregulation. Further investigation to identify these changes is warranted to clarify this issue in the future.
Up to now, the organization of regulatory elements required for cytokine-induced expression of VCAM-1 has only been partially defined (28, 29). In an effort to understand the transcription factors controlling the VCAM-1 response to HIMF, we conducted transient transfection experiments with segments of VCAM-1 5'-flanking promoter sequence coupled to a luciferase reporter (19). We found that a small region upstream of the transcription start site, which contains a tandem binding site for NF- B, is capable of directing highest HIMF-induced VCAM-1 expression. This finding is consistent with the previous finding that activation of VCAM-1 requires two tandem binding sites for NF- B, located in the basal VCAM-1 promoter at positions 73 and 58, both of which are necessary for cytokine-mediated transcriptional response (28, 30). Mutation of either of these elements abolishes cytokine responsiveness (28). Studies of human VCAM-1 promoter also suggest that TNF- mediated activation of VCAM-1 transcription in endothelial cells is dependent, at least in part, on the activation of NF- B transcription factors (28). In addition, Kawanami and colleagues found that C-reactive protein induces VCAM-1 expression in an NF- Bdependent mechanism, which further emphasizes the importance of NF- B in VCAM-1 gene expression (31). In this study, we found that, in SVEC 4-10 and MLE-12 cells, HIMF induces NF- B activation in a dose-dependent manner. When HIMF-induced NF- B activation was blocked by transfection of dominant-negative mutants in the NF- B pathway, IKK (K44A), IKK (K44A), and I B (S32A/S36A), the VCAM-1 promoter activity and its expression were also decreased accordingly. These results demonstrate that activation of NF- B is essential for HIMF-induced VCAM-1 expression in mouse endothelial and epithelial cells, and, for the first time, connect HIMF signaling to the NF- B pathway.
NF- B is a dimeric, ubiquitously expressed transcription factor that plays a critical role in regulating inducible gene expression in inflammatory responses (32). In resting cells, NF- B is normally sequestered in the cytoplasm through its interaction with the I B (inhibitory of NF- B) family of inhibitory proteins (33). In response to external stimuli, I B proteins undergo rapid phosphorylation on specific serine residues. Phosphorylation of I B on serines 32 and 36, and of I B on serines 19 and 23, facilitates their ubiquitination on neighboring lysine residues, thereby targeting these proteins for rapid degradation by the proteosome (32). After the degradation of I B, NF- B is released and is free to translocate to the nucleus and to activate target genes. A key regulatory step in this pathway is the activation of a high molecular weight IKK complex, in which catalysis is carried out by multiple kinases, including IKK and IKK (33). In the present study, we found that phosphorylation of IKK was induced by administration of HIMF. Moreover, transfection of dominant-negative mutants of IKK and IKK inhibited HIMF-induced NF- B activation. In addition, dominant-negative mutant of IKK exhibited more pronounced inhibitory effects on HIMF-induced NF- B activation than that of IKK . Our observations are consistent with data obtained from gene targeting studies that suggest IKK , but not IKK , plays a major role in the induction of NF- B activity in response to inflammatory stimuli (34).
Substantial progress has been made in understanding the signal transduction pathways regulating activation of NF- B in response to proinflammatory cytokines, such as TNF- and IL-1 (32). PI-3K stimulates NF- B activation through a downstream serine/threonine kinase Akt, as shown in TNF- and platelet-derived growth factorinduced NF- B activation (22, 23). PI-3K is a lipid kinase that is composed of two polypeptides: a p85 regulatory subunit, and a p110 catalytic subunit. This kinase is activated by a large spectrum of cytokines, hormones, and growth factors (35). Our results demonstrate that HIMF induced Akt phosphorylation in both SVEC 4-10 and MLE-12 cells. The time course of the induced Akt activation is compatible with that of NF- B activation in HIMF-stimulated cells. Pretreatment of cells with a PI-3Kspecific inhibitor, LY294002, attenuated HIMF-induced Akt phosphorylation. Furthermore, transfection of p85, the dominant-negative mutant of PI-3K, into cells blocked HIMF-induced phosphorylation of IKK and I B , resulting in inhibition of NF- B activation and VCAM-1 production. These results placed PI-3K/Akt downstream of HIMF, but upstream of NF- B.
In summary, the present study shows that HIMF induces VCAM-1 production in mouse lung tissues, cultured endothelial cell lines, and epithelial cell lines. The induction is dependent on activation of NF- B, an important transcription factor that binds VCAM-1 promoter. We also explored how NF- B is activated, and found that PI-3K/Akt pathway acts upstream of IKK signalsome. Combined with our recent findings that LPS induces HIMF production in mouse lungs, these results suggest that HIMF plays critical roles in lung inflammatory processes, especially inflammatory cell adhesion and migration.
 |
Acknowledgments
|
|---|
The authors thank Dr. Joji Ando (Department of Biomedical Engineering, Graduate School of Medicine, University of Tokyo, Tokyo, Japan) for providing the mouse VCAM-1 promoterluciferase reporter constructs. They also appreciate Dr. Chuanshu Huang (Nelson Institute of Environmental Medicine, New York University School of Medicine, Tuxedo, NY) for his kind gift of PI-3K dominant-negative mutant and Dr. Andrew Lechner (Department of Pharmacology and Physiological Sciences, Saint Louis University, St. Louis, MO) for critical review of this manuscript.
 |
Footnotes
|
|---|
This work was supported by National Institutes of Health grants HL075755 (D.L.) and CA104912 (L.L.).
Originally Published in Press as DOI: 10.1165/rcmb.2005-0424OC on May 18, 2006
Conflict of Interest Statement: None of the authors has a financial relationship in a commercial entity that has an interest in the subject of this manuscript.
Received in original form November 16, 2005
Accepted in final form March 8, 2006
 |
References
|
|---|
- Lukacs NW, Ward PA. Inflammatory mediators, cytokines, and adhesion molecules in pulmonary inflammation and injury. Adv Immunol 1996;62:257304.[Medline]
- Springer TA. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell 1994;76:301314.[CrossRef][Medline]
- Carlos TM, Harlan JM. Leukocyte-endothelial adhesion molecules. Blood 1994;84:20682101.[Abstract/Free Full Text]
- Elices MJ, Osborn L, Takada YL, Crouse C, Luhoowskyi S, Helmer ME, Lobb RR. VCAM-1 on activated endothelium interacts with the specific leukocyte integrin VLA-4 at a site distinct from VLA-4/fibronectin binding site. Cell 1990;60:577584.[CrossRef][Medline]
- Henseleit U, Steinbrink K, Sunderkotter C, Goebeler M, Roth J, Sorg C. Expression of murine VCAM-1 in vitro and in different models of inflammation in vivo: correlation with immigration of monocytes. Exp Dermatol 1994;3:249256.[CrossRef][Medline]
- Haraldsen G, Kvale D, Lien B, Farstad IN, Brandtzaeg P. Cytokine-regulated expression of E-selectin, intercellular adhesion molecule-1 (ICAM-1), and vascular cell adhesion molecule-1 (VCAM-1) in human microvascular endothelial cells. J Immunol 1996;156:25582565.[Abstract]
- Van Kampen C, Mallard BA. Regulation of bovine intercellular adhesion molecule 1 (ICAM-1) and vascular cell adhesion molecule 1 (VCAM-1) on cultured aortic endothelial cells. Vet Immunol Immunopathol 2001;79:129138.[CrossRef][Medline]
- van Oosten M, van de Bilt E, de Vries HE, van Berkel TJ, Kuiper J. Vascular adhesion molecule-1 and intercellular adhesion molecule-1 expression on rat liver cells after lipopolysaccharide administration in vivo. Hepatology 1995;22:15381546.[CrossRef][Medline]
- Woo CH, Lim JH, Kim JH. VCAM-1 upregulation via PKC
-p38 kinase-linked cascade mediates the TNF- induced leukocyte adhesion and emigration in the lung airway epithelium. Am J Physiol Lung Cell Mol Physiol 2005;288:L307L316.[Abstract/Free Full Text] - Teng X, Li D, Champion HC, Johns RA. FIZZ1/RELM
, a novel hypoxia-induced mitogenic factor in lung with vasoconstrictive and angiogenic properties. Circ Res 2003;92:10651067.[Abstract/Free Full Text] - Holcomb IN, Kabakoff RC, Chan B, Baker TW, Gurney A, Henzel W, Nelson C, Lowman HB, Wright BD, Skelton NJ, et al. FIZZ1, a novel cysteine-rich secreted protein associated with pulmonary inflammation, defines a new gene family. EMBO J 2000;19:40464055.[CrossRef][Medline]
- Steppan CM, Brown EJ, Wright CM, Bhat S, Banerjee RR, Dai CY, Enders GH, Silberg DG, Wen X, Wu GD, et al. A family of tissue-specific resistin-like molecules. Proc Natl Acad Sci USA 2001;98:502506.[Abstract/Free Full Text]
- Liu T, Jin H, Ullenbruch M, Hu B, Hashimoto N, Moore B, McKenzie A, Lukacs NW, Phan SH. Regulation of found in inflammatory zone 1 expression in bleomycin-induced lung fibrosis: role of IL-4/IL-13 and mediation via STAT-6. J Immunol 2004;173:34253431.[Abstract/Free Full Text]
- Li D, Fernandez LG, Dodd-o J, Langer J, Wang D, Laubach VE. Upregulation of hypoxia-induced mitogenic factor in compensatory lung growth after pneumonectomy. Am J Respir Cell Mol Biol 2005;32:185191.[Abstract/Free Full Text]
- Wagner KF, Hellberg AK, Balenger S, Depping R, Dodd O, Johns RA, Li D. Hypoxia-induced mitogenic factor has antiapoptotic action and is upregulated in the developing lung: coexpression with hypoxia-inducible factor-2
. Am J Respir Cell Mol Biol 2004;31:276282.[Abstract/Free Full Text] - Tong Q, Zheng L, Dodd-o J, Langer J, Wang D, Li D. Hypoxia-induced mitogenic factor modulates surfactant protein b and c expression in mouse lung. Am J Respir Cell Mol Biol 2006;34:2838.[Abstract/Free Full Text]
- Fu D, Kobayashi M, Lin L. A p105-based inhibitor broadly represses NF-
B activities. J Biol Chem 2004;279:1281912826.[Abstract/Free Full Text] - Huang C, Ma WY, Dong Z. Requirement for phosphatidylinositol 3-kinase in epidermal growth factor-induced AP-1 transactivation and transformation in JB6 P+ cells. Mol Cell Biol 1996;16:64276435.[Abstract]
- Korenaga R, Ando J, Kosaki K, Isshiki M, Takada Y, Kamiya A. Negative transcriptional regulation of the VCAM-1 gene by fluid shear stress in murine endothelial cells. Am J Physiol Cell Physiol 1997;273:C1506C1515.[Abstract/Free Full Text]
- Croft D, McIntyre P, Wibulswas A, Kramer IJ. Sustained elevated levels of VCAM-1 in cultured fibroblast-like synoviocytes can be achieved by TNF-
in combination with either IL-4 or IL-13 through increased mRNA stability. Am J Pathol 1999;154:11491158.[Abstract/Free Full Text] - Collins T, Read MA, Neish AS, Whitley MZ, Thanos D, Maniatis T. Transcriptional regulation of endothelial cell adhesion molecules: NF-
B and cytokine-inducible enhancers. FASEB J 1995;9:899909.[Abstract] - Nidai Ozes O, Mayo LD, Gustin JA, Pfeffer SR, Pfeffer LM, Donner DB. NF-
B activation by tumour necrosis factor requires the Akt serine-threonine kinase. Nature 1999;401:8285.[CrossRef][Medline] - Romashkova JA, Makarov SS. NF-
B is a target of AKT in anti-apoptotic PDGF signalling. Nature 1999;401:8690.[CrossRef][Medline] - Chin JE, Hatfield CA, Winterrowd GE, Brashler JR, Vonderfecht SL, Fidler SF, Griffin RL, Kolbasa KP, Krzesicki RF, Sly LM, et al. Airway recruitment of leukocytes in mice is dependent on
4-integrins and vascular cell adhesion molecule-1. Am J Physiol Lung Cell Mol Physiol 1997;272:L219L229.[Abstract/Free Full Text] - Cunningham AC, Milne DS, Wilkes J, Dark JH, Tetley TD, Kirby JA. Constitutive expression of MHC and adhesion molecules by alveolar epithelial cells (type II pneumocytes) isolated from human lung and comparison with immunocytochemical findings. J Cell Sci 1994;107:443449.[Abstract]
- Papi A, Johnston SL. Respiratory epithelial cell expression of vascular cell adhesion molecule-1 and its up-regulation by rhinovirus infection via NF-
B and GATA transcription factors. J Biol Chem 1999;274:3004130051.[Abstract/Free Full Text] - Rosseau S, Selhorst J, Wiechmann K, Leissner K, Maus U, Mayer K, Grimminger F, Seeger W, Lohmeyer J. Monocyte migration through the alveolar epithelial barrier: adhesion molecule mechanisms and impact of chemokines. J Immunol 2000;164:427435.[Abstract/Free Full Text]
- Neish AS, Williams AJ, Palmer HJ, Whitley MZ, Collins T. Functional analysis of the human vascular cell adhesion molecule 1 promoter. J Exp Med 1992;176:15831593.[Abstract/Free Full Text]
- Cybulsky MI, Allan-Motamed M, Collins T. Structure of the murine VCAM1 gene. Genomics 1993;18:387391.[CrossRef][Medline]
- Shu HB, Agranoff AB, Nabel EG, Leung K, Duckett CS, Neish AS, Collins T, Nabel GJ. Differential regulation of vascular cell adhesion molecule 1 gene expression by specific NF-
B subunits in endothelial and epithelial cells. Mol Cell Biol 1993;13:62836289.[Abstract/Free Full Text] - Kawanami D, Maemura K, Takeda N, Harada T, Nojiri T, Saito T, Manabe I, Imai Y, Nagai R. C-reactive protein induces VCAM-1 gene expression through NF-
B activation in vascular endothelial cells. Atherosclerosis 2006;185:3946.[CrossRef][Medline] - Baldwin AS. The NF-
B and I B proteins: new discoveries and insights. Annu Rev Immunol 1996;14:649681.[CrossRef][Medline] - Karin M. How NF-
B is activated: the role of the I B kinase (IKK) complex. Oncogene 1999;18:68676874.[CrossRef][Medline] - Hu Y, Baud V, Delhase M, Zhang P, Deerinck T, Ellisman M, Johnson R, Karin M. Abnormal morphogenesis but intact IKK activation in mice lacking the IKK
subunit of I B kinase. Science 1999;284:316320.[Abstract/Free Full Text] - Fry MJ. Structure, regulation and function of phosphoinositide 3-kinases. Biochim Biophys Acta 1994;1226:237268.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
C.-W. Lee, C.-C. Lin, S.-F. Luo, H.-C. Lee, I.-T. Lee, W. C. Aird, T.-L. Hwang, and C.-M. Yang
Tumor Necrosis Factor-{alpha} Enhances Neutrophil Adhesiveness: Induction of Vascular Cell Adhesion Molecule-1 via Activation of Akt and CaM Kinase II and Modifications of Histone Acetyltransferase and Histone Deacetylase 4 in Human Tracheal Smooth Muscle Cells
Mol. Pharmacol.,
May 1, 2008;
73(5):
1454 - 1464.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|