help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published ahead of print on June 29, 2006, doi:10.1165/rcmb.2006-0073OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supplement
Right arrow All Versions of this Article:
2006-0073OCv1
35/6/668    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tao, T.
Right arrow Articles by Kaplan, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tao, T.
Right arrow Articles by Kaplan, F.
American Journal of Respiratory Cell and Molecular Biology. Vol. 35, pp. 668-680, 2006
© 2006 American Thoracic Society
DOI: 10.1165/rcmb.2006-0073OC

Importin 13 Regulates Nuclear Import of the Glucocorticoid Receptor in Airway Epithelial Cells

Tao Tao*, Jie Lan, Gergely L. Lukacs, Robert J. G. Haché and Feige Kaplan

McGill University–Montreal Children's Hospital Research Institute, Montreal; Departments of Human Genetics and Pediatrics, McGill University, Montreal, Quebec; The Hospital for Sick Children Research Institute, University of Toronto, Toronto; The Ottawa Health Research Institute, Faculty of Medicine, University of Ottawa, Ottawa, Ontario, Canada

Correspondence and requests for reprints should be addressed to Feige Kaplan, McGill University–Montreal Children's Hospital Research Institute, 4060 St. Catherine St. West, Rm 236, Montreal, PQ, H3Z 2Z3 Canada. E-mail: feige.kaplan{at}mcgill.ca


    Abstract
 Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Antiinflammatory effects of glucocorticoids are critical to treatment of airway inflammation in such common disorders as asthma. There is considerable variation in responsiveness to glucocorticoid, and prolonged exposure can result in glucocorticoid resistance. We cloned LGL2, a glucocorticoid-inducible gene in fetal rat lung. We described the characterization of lgl2 as a nuclear transport protein, classified as importin 13 (IPO13), and demonstrated developmental regulation of IPO13 nucleocytoplasmic shuttling. We now report on the identification of the glucocorticoid receptor (GR) as a cargo substrate for IPO13. Binding of GR and IPO13 was demonstrated by GR-GST pulldown and coimmunoprecipitation. To investigate the role of IPO13 in modulating GR signaling in the lung, we studied IPO13-regulated GR transport in airway epithelial cells. Small interfering RNAs that inhibited IPO13 synthesis prevented nuclear translocation of GR. Silencing of IPO13 also abrogated the ability of cortisol to inhibit synthesis of the inflammatory cytokine IL-8 after stimulation with TNF-{alpha}. Our findings support a role for IPO13 in promoting nuclear occupancy of GR in a way that strongly potentiates the antiinflammatory effects of glucocorticoids. We speculate that variation in cellular levels of IPO13 and intracellular IPO13 shuttling rates may contribute to glucocorticoid resistance.

Key Words: asthma • gluccorticoid receptor • glucocorticoid responsiveness • importin 13 • nuclear import



    CLINICAL RELEVANCE
 Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
This study identified a glucocorticoid receptor (GR) nuclear transport carrier in the lung. These findings support a role for importin 13 in promoting nuclear entry of GR and may be of relevance to antiinflammatory asthma therapy.

 
Glucocorticoids (GCs) are among the most effective and extensively used pharmaceutical agents in the world. Antiinflammatory effects of GCs are critical to treatment of airway inflammation in such common disorders as asthma and chronic obstructive pulmonary disease (COPD). Immunosuppressive benefits of GCs also often form an essential component of chemotherapeutic regimens and management of autoimmune disease. Although it is as yet not entirely clear how GCs suppress inflammation, potent antiinflammatory and immunosuppressive effects of GCs have been shown to function in a cell type–specific manner, largely through interruption of cytokine-mediated pathways (1). The GCs inhibit transcription of a number of cytokines relevant to inflammatory lung disease, including IL-1beta, TNF{alpha}, granulocyte-macrophage colony–stimulating factor, and IL-4,-5, and -8 (2). There is considerable variation in responsiveness to GC therapy among individuals, and prolonged exposure to GC can result in GC resistance (3, 4). The molecular mechanism(s) of GC resistance remains incompletely understood.

Most, if not all, of the effects of GCs are mediated by the GC receptor (GR), a prototype member of the nuclear receptor superfamily of transcriptional regulators. In the absence of ligand, the GR is complexed to heat-shock proteins in the cytoplasmic compartment of the cell. After ligand binding, the receptor dissociates from the complex and translocates to the nucleus, where it can induce or repress transcription via interactions with positive and negative GC responsive elements within the DNA of target genes (2, 4). In the absence of DNA binding, GR can also alter transcription of genes via protein–protein interactions. In particular, GR can inhibit the action of other transcription factors, such as NF-{kappa}B and activator protein (AP)-1 (14).

The extent of the cellular response to GCs is likely to be dependent on available hormone levels, cellular concentration of GR, the efficiency of GR-mediated signal transduction, and the genomic accessibility of GR-responsive genes (reviewed in Ref. 5). Moreover, the composition and proportion of multiple GR isoforms, generated by alternate splicing, and expressed in particular cellular contexts, is likely to contribute to the diversity of GC effects in vivo (5). In humans, alternative splicing of the ninth exon of GR gives rise to two isoforms of the protein, human GR (hGR) {alpha} and hGRbeta, which are 94% identical and diverge only at the carboxyl terminus (5). Whereas hGRbeta (amino acids [aa] 1–742, Figure 1A) and C-terminal truncated hGR{alpha} (aa 1–727) localize primarily to the nucleus, ligand-free hGR{alpha} (aa 1–777) is cytoplasmic, suggesting that subcellular localization of hGR{alpha} may be dependent on its C-terminal peptide (6). Unlike hGR{alpha}, hGRbeta does not bind hormone or activate gene expression. Human GRbeta is believed to function as a dominant negative inhibitor of hGR{alpha} (7). A number of studies have implicated hGRbeta as a contributing factor to GC resistance in pathological conditions, including asthma (4, 8). The role of other GR splice variants in differential GC responsiveness is less well understood.


Figure 1
View larger version (38K):
[in this window]
[in a new window]
 
Figure 1. Nuclear entry of GR is blocked by the C-terminal portion of IPO13. (A) Human glucocorticoid receptor indicating hGR{alpha} and hGRbeta proteins. Below are indicated the full-length, N-terminal and C-terminal EYFP-tagged IPO13 plasmids, which were transiently expressed in HeLa cells (B, green color). (B) After 24-h expression, cells were incubated with 10–5 M cortisol for 2 h before fixation. Endogenous GR was detected using a polyclonal anti-GR antibody (B, red color). Neither full-length (a, b) nor N-terminal (c, d) IPO13 protein inhibited nuclear entry of GR. By contrast, the C-terminal IPO13 fragment blocked the nuclear import of GR (e, f, g, h). (C) Quantitation of transfected cells with nuclear accumulation of endogenous GR in the presence of cortisol. Error bars represent 1 SD.

 
Nuclear hormone receptors are dynamic transcription factors that shuttle between the nucleus and the cytoplasm. Bidirectional nuclear–cytoplasmic transport through nuclear pore complexes is mediated by transport factors that target import of cargo substrates by interacting with cognate nuclear localization sequences (NLS). Nucleocytoplasmic shuttling of GR allows for rapid modulation of receptor function in response to cytoplasmic signals. Two domains of hGR{alpha} have been found to be involved in its nuclear translocation after ligand binding (see Figure 1A) (9). The first, NL1 is a classical basic NLS, which localizes to aa 478–500 in the C-terminal region of the DNA binding domain (DBD). In addition to NL1, however, the import of GR is facilitated by NL2, a second NLS that occurs in the 225-amino acid GR ligand-binding domain (9). The exact location of NL2 is unknown. NL2-mediated nuclear import of GR is slower than translocation via NL1 and is hormone dependent (10). Interestingly, recent results suggest that nuclear import of GR may be accomplished by multiple transport proteins, providing the opportunity for context-specific regulation (11).

In a search for GC-regulated genes important in lung development, we cloned importin (IPO) 13 (originally named LGL2), a GC-inducible gene in fetal rat lung cell culture (12). The 3.6-kb IPO13 cDNA encodes a deduced polypeptide (IPO13) of 963 aa (12). IPO13 was differentially expressed in fetal lung, induced by GC, and enriched in epithelium relative to the mesenchyme. Our initial comparison with sequences in the genome database identified the lgl2 (IPO13) protein as a member of the importin beta family of nuclear import proteins. More recently, we described the functional characterization of the IPO13 protein and demonstrated developmental regulation of its nucleocytoplasmic shuttling in fetal lung (13). We hypothesized that the hormonal, temporal, and spatial regulation of IPO13 (12, 13) would reflect the need for strictly regulated subcellular localization of developmentally regulated cargo substrates. Moreover, all of these properties of IPO13 were consistent with a role for IPO13 in mediating GC signaling in the lung. Accordingly, we investigated the role of IPO13 in mediating nuclear entry of the GR, initially in HeLa cell culture, and then in airway epithelial cells. Our findings support a role for IPO13 in promoting nuclear occupancy of GR in a way that potentiates the antiinflammatory effects of GC. We speculate that variation in both cellular levels of IPO13 and intracellular IPO13 shuttling rates may contribute to GC resistance.


    MATERIALS AND METHODS
 Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Expression Constructs
We used hemagglutinin (HA) (pcDNA3.1-IPO13-HA) or enhanced yellow fluorescence protein (EYFP) tagged IPO13 (LGL2) expression vectors (13) to express full-length and C-terminal IPO13 proteins. Plasmids pEGFP-GR and pEGFP-GRNL1 (replacement of lysines 513–515 with asparagines inactivates NL1) were prepared as we have previously described (10). A human IPO8 cDNA plasmid was kindly provided by K.R. Yamamoto. A single set of primers (5'-ATTTGCGGCCGCGATGGACCTC AACCGGTTC-3'and 5'-ATTTGCGGCCGCGTTGTTGCTGGGCACAG-3') with a NotI overhang was used to amplify IPO8 to clone it into the pCMV-HA vector NotI restriction site. For siRNA studies, the following plasmids and siRNA sequences were purchased from Ambion (Austin, TX): plasmids pSilencer1.0-U6 siRNA and pSilencer 1.0-U6 GAPDH (psiGAPDH); IPO13 5' siRNA: sense strand (5'–3'), GGUGCCUGAGAUCCAGUACTT; antisense strand (5'–3'), GUACUGGAUCU CAGGCACCTT; IPO13 3' siRNA: sense strand (5'–3'), GGAGAUG GUGAAGGA AUUUTT; antisense strand (5'–3'), AAAUUC CU U CACCAUCUCCTT; IPO8 siRNA: sense strand (5'–3'), ACCAGUCCACAAGAUUA UTT antisense strand (5'–3'), AUAAUCUUGUAGGACUGGUTG.

To express the 5' IPO13 siRNA using plasmid pSilencer1.0-U6, two oligonucleotide templates with restriction enzymes EcoR I and Apa I overhangs were synthesized: 5'-GGTGCCTGAGATCCAGTACTT CAAGAGAGTACTGA TCTCAGGCACCTTTTTT-3' and 5'-AATAAAAAAGGTGCCTGAGATCCAGTACTCTCT TG AAGTACTGGATCT AGGCACCGGCC-3'. To express the 3' IPO13 siRNA, the following oligonucleotide templates with restriction enzymes EcoRI and ApaI overhangs were synthesized: 5'-GGAGATGGTGAAGGAATTTCTCA AGAGAAAATTCCTTCACCATCTCCTTTTTT-3' and 5'AATTAAAAAAGGAGATGGTGAAGGAATTTTCTCTTGAGAAATTCCTTCACCA TCTCCGGCC-3'. To express the IPO8 siRNA, two oligonucleotide templates with restriction enzymes EcoRI and ApaI overhangs were synthesized: 5'-ACCAGTCCTACAAGATTATCTCAAGAGAATAATCTTGTAGGACTGGTTGTTTTTT-3' and 5'-AATTAAAAAACAACCAGTCCTACAAGATTATTCTCTTGAGATAATCTTGTAG G ACTGGTGGCC-3'. The following scrambled oligonucleotide templates (without homology to human or rodent sequences) were also prepared as a control for silencing experiments: 5'-ACTACCGTTGTTATAGGTGTTCAAGAGACACCTATAACAACGGTAGTTTTTTT-3' and 5'-AATTAAAAAAACTACCGTTGTTATAGGTGTCTCTTGAACACCTATAACAACG GTAGTGGCC-3'. Oligonucleotides were annealed and ligated into pSilencer 1.0-U6 siRNA vector. After selection, plasmids pSilencer1.0-U6 IPO13-5' (psiIPO13-5'), pSilencer1.0-U6 IPO13-3' (psiIPO13-3'), pSilencer1.0-U6-IPO8 (psiIPO8), and pSilencer1.0-U6-control (psiControl), or pSilencer1.0-U6 GAPDH (psiGAPDH) were transfected into cells as outlined below.

Establishment of Primary Lung Cell Culture
Procedures involving animals were carried out according to criteria established by the Canadian Council for Animal Care and approved by the Animal Care Committee at the McGill University Health Centre. Wistar rats (Charles River, PQ, Canada) were killed with CO2 at postnatal day (PN) 7, and lungs immediately excised. Lung epithelial cells were isolated as we previously described (14).

Cell Culture and Transfection
Adherent HeLa cells, A549 type II cells or PN7 rat lung epithelial cells (PN7epi) were grown in Dulbecco's modified Eagle's medium (DMEM; Invitrogen, Carlsbad, CA) plus 10% decomplemented FBS and incubated at 37°C in a 5% CO2/air incubator. For microscopic examination, cells on glass coverslips (12 mm) were usually seeded at 5.0 x 104 cells/coverslip the day before transfection. Plasmid DNA (0.25–0.5 µg/plasmid/coverslip) was transfected into cells using the Effectene transfection kit (no. 301425; QIAGEN, Hilden, Germany). For GR nuclear entry, cells were usually seeded in DMEM plus 10% decomplemented FBS. After overnight culture, cells were washed 3 times in DMEM and reincubated in DMEM with 10% charcoal-treated FBS (no. CBX3634; Cocalico Biologicals Inc., Reamstown, PA) overnight; 10–5 M cortisol was added to culture media and cells were incubated for another 1–2 h before fixation. For IL-8 detection, after incubation in the presence of 10–7–10–5 M cortisol (final concentration) or 10–7 M dexamethasone (Dex) for 1 h, TNF-{alpha} (no. 554618; BD Bioscience, San Jose, CA) was added to culture media to a final concentration of 10 ng/ml, and cells were further incubated for 3 h before fixation. For preparation of lysates, cells were usually seeded at 1 x 106 cells/100-mm plate the day before transfection. One 2 µg sample of plasmid DNA/plate was transfected into HeLa, A549, or PN7epi cells using the Effectene transfection kit. After 24-h expression, transfected cells were lysed for further analysis.

Indirect Immunofluorescence
A rabbit polyclonal IPO13 antibody raised against two synthetic peptides ([C]-LPEEFQTSRLPQYRKGLVR-amide and [C]-EQKDTFSQQILRERVN KRRVK-amide) was generated by Covance Research Products Inc. (Denver, PA). Cell coverslips were fixed by 3.7% formaldehyde for 30 min on ice and then quenched and permeabilized with 0.1 M glycine (pH 7.0), 0.1% Triton X-100 in PBS. These coverslips were stained with anti-IPO13 antibodies, polyclonal anti-HA antibodies (1 ng/µg, no. sc-805; Santa Cruz Biotechnology, Santa Cruz, CA), or an anti-GR antibody (no. sc-8992, Santa Cruz Biotechnology) for 1 h at room temperature and subsequently labeled with FITC or rhodamine isothiocyanate (RITC)–conjugated secondary antibodies (goat anti-rabbit IgG [5 ng/µl], no. T6778; Sigma, St. Louis, MO) for another hour at room temperature. For IL-8 detection, cell coverslips were fixed and stained with anti-human IL-8 antibody and subsequently labeled with FITC-conjugated goat anti-mouse IgG. In all experiments, a minimum of 10 cells was analyzed for each determination in 3 experiments.

Western Blot Analysis
Samples were electrophoresed on 10% SDS-polyacrylamide gels (29:1) and transferred to PVDF membrane (no. 162–0177; Bio-Rad, Hercules, CA) using 1x transfer buffer (39 mM glycine, 48 mM Tris, 0.037% SDS, 10% methanol) for 1 h. Membranes were blocked in TBS-T buffer (20 mM Tris-HCl, pH 7.6, 137 mM NaCl, 0.1% Tween-20) containing 5% skim milk at room temperature for 1 h and incubated with primary antibody in the same blocking solution at room temperature for 2 h. Membranes were washed in TBS-T buffer without milk after the enhanced chemiluminescence protocol and subsequently incubated with HRP-conjugated secondary antibodies (no. NA934/NA934V; Amersham, Piscataway, NJ) at room temperature for 2 h. The enhanced chemiluminescence Western blot kit was used for protein detection (no. RPN 2209; Amersham). Anti-IPO13 or a monoclonal anti-HA antibody (15 ng/µl, no. MMS-101R; BAbCO, Richmond, CA) were used for Western analysis.

Protein Expression and Purification
A single set of primers (5'-GCGGATCCGACTCCAA AGAATCCTTAGCT-3', 5'-AGGCCCGGGTCATTTCTGATGAAACAG-3') was used to amplify the mouse GR cDNA (with BamHI and SmaI overhangs), which was then cloned into the pGEX4T-2 restriction site to produce GST-tagged GR. pGEX-GST-GR was transformed into Escherichia coli DH5{alpha} strain (no. 18265-017; Invitrogen) and the expression of GR-GST was induced by 0.5 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) in Luria-Bertani (LB) medium containing selective antibiotic with vigorous shaking for 3 h. When the optical density of E. coli cells reached 0.5, culture was collected by centrifugation and pellet was resuspended in PBS buffer with 10% Triton X-100 and 1 mM PMSF. Cells were sonicated for 10 min with VibraCell (Sonics & Materials Inc., Danbury, CT) and centrifuged at 15,800 x g for 20 min. The supernatant was collected, and recombinant GST-GR protein was purified on glutathione Sepharose 4B.

GST Pull-Down
At 24 h after transfection with IPO13-HA, HeLa cells grown on 100-mm plates were washed twice with cold PBS. Cells were scraped into 1 ml lysis buffer (50 mM HEPES-NaOH [pH 7.5], 100 mM NaCl, 0.5% NP-40, 2.5 mM EDTA, 10% glycerol, 1 mM DTT, 1 mM PMSF, and 1% proteinase inhibitor cocktail [no. P8340; Sigma]). The mixture was incubated on ice for 15–20 min and shaken gently every 3 min. After lysis, the supernatant was collected by centrifugation at 15, 800 x g for 20 min at 4oC. A 50% glutathione Sepharose 4B slurry was saturated with GST-GR or GST at 4°C overnight. The mixture was washed three times in HeLa cell lysis buffer. GST-GR glutathione Sepharose 4B beads (or GST beads) were incubated with 1 ml untransfected HeLa cell lysate or HeLa lysate transfected with IPO13-HA, at 4°C for 2 h. After binding, the mixture was spun at 300 x g for 5 min to collect the beads. The beads were then washed three times in cell lysis buffer containing no proteinase inhibitor cocktail. SDS-PAGE (2x) loading buffer was mixed with beads and boiled for 5 min. Samples were subsequently analyzed by Western blotting.

Coimmunoprecipitation
At 24 h after transfection, HeLa cells grown in 100-mm plates were washed twice in cold PBS. Cells were scraped into 1 ml lysis buffer (50 mM HEPES-NaOH [pH 7.5], 100 mM NaCl, 0.5% NP-40, 2.5 mM EDTA, 10% glycerol, 1 mM DTT, 1 mM PMSF, and 1% proteinase inhibitor cocktail [no. P8340; Sigma]). The mixture was incubated on ice for 15–20 min and shaken gently every 3 min. After lysis, the supernatant was collected by centrifugation at 15, 800 x g for 20 min at 4°C. A 1-µg aliquot of rabbit anti-HA, anti-GR, or mouse anti-GFP antibody was added to supernatants, and the mixtures were rotated slowly at 4°C overnight, after which 10 µl of a 50% slurry of washed protein G Sepharose 4B beads (no. P-3296; Sigma) was added to the mixtures. Mixtures were rotated slowly at 4°C for another 2 h. The beads were collected by centrifugation at 300 x g for 2 min, washed in lysis buffer at least 3 times, and boiled with 2x SDS loading buffer for 5 min. The boiled mixtures were centrifuged briefly and supernatants loaded on SDS-PAGE gel.

Statistical Analysis
All data are presented as mean ± SEM. Statistical significance was determined by two-way ANOVA. Pair-wise group comparisons were then assessed using Student-Neuman-Keuls test.


    RESULTS
 Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Nuclear Entry of GR Is Blocked by the C-Terminal Fragment of IPO13
We searched for GC-inducible genes in developing lung and identified IPO13 (originally called LGL2) (12) encoding IPO13, a novel importin beta protein (13). We then showed that the nucleocytoplasmic shuttling of IPO13 is developmentally regulated in a manner consistent with its modulation of GC-GR–regulated signal transduction pathways that govern lung organogenesis (13). We therefore considered GR as a potential cargo substrate of IPO13.

To determine whether IPO13 regulates nuclear import of endogenous GR, we initially asked whether full-length IPO13, its N-terminal fragment (essential for nuclear import), or its C-terminal fragment (13) would influence the subcellular localization of GR in the presence of cortisol. Cortisol induces rapid transfer of GR from the cytoplasm to the nucleus. The C-terminal fragment of IPO13 contains the predicted cargo binding domain, but lacks the NH2-terminal portion, which is essential for nuclear import. The C-terminal fragment would therefore be expected to act as a dominant negative inhibitor, binding to and preventing nuclear import of cargo substrates. We initially transfected full-length (pFIPO13-EYFP), N-terminal, (pNIPO13–EYFP aa 1–488, 75 kd), or C-terminal (pCIPO13-EYFP, aa 489–963, 75 kd) IPO13 expression plasmids driven by the CMV promoter (Figure 1A) into HeLa cells. All three proteins were expressed at high levels after transfection (13). Under fluorescence microscopy, we observed that expression of both full-length (Figure 1B; a, b) and N-terminal (Figure 1B; c, d) IPO13-EYFP–supported nuclear import of GR. By contrast, expression of C-terminal IPO13-EYFP (Figure 1B; e, f; g, h) consistently inhibited nuclear entry of GR (three experiments, a minimum of n = 10 cells). In the presence of C-terminal IPO13-EYFP, the percent of cells in which with GR localized to the nucleus was reduced by 70% (Figure 1C). These initial findings implicated IPO13 as a potential regulator of GR import by showing that overexpression of a C-terminal fusion protein construct acted as a dominant negative inhibitor of steroid-dependent transfer of GR to the nucleus of cells.

Immobilized Recombinant GR Binds IPO13
We next sought to establish whether IPO13-mediated regulation of GR import would involve a physical interaction between the two proteins. The intracellular mobility of hGR{alpha} has been reported to be cell-type specific (15). The expression of IPO13 demonstrates tissue specificity, and its nucleocytoplasmic shuttling is developmentally regulated (12, 13). As we were interested in the effects of GC-GR signaling in the lung, we initially used Western blot analysis to evaluate expression of IPO13 in lysates of A549 cells (a transformed cell line derived from lung adenocarcinoma) and airway epithelial cells isolated from PN7 rat lung (PN7epi) in the presence/absence of transfected recombinant IPO13-HA. Significant endogenous expression of IPO13 protein was observed in HeLa, A549, and PN7epi cells (Figure 2A). In order to determine whether IPO13 formed a binding complex with GR, we then used a GST-protein pulldown assay with purified immobilized GR. GR was expressed in E. coli as a GST-fusion protein and immobilized on glutathione-Sepharose beads. GST-GR–saturated beads were incubated with HeLa cell lysates prepared from untransfected or IPO13-HA–transfected cells. Proteins retained were analyzed by SDS-PAGE. Endogenous and recombinant IPO13 proteins were detected by anti-IPO13 and anti-HA antibodies (Figure 2B). Only recombinant IPO13-HA was detected by an anti-HA antibody in transfected cells. No IPO13 was detected when transfected or untransfected HeLa cells were incubated with GST-saturated beads.


Figure 2
View larger version (68K):
[in this window]
[in a new window]
 
Figure 2. IPO13 forms a binding complex with GR. (A) Endogenous expression of IPO13 in HeLa, A549, and PN7epi cells. Cells were transfected with pIPO13-HA and fixed after 24 h. Lysates prepared from transfected or control cells were resolved on SDS gels and subjected to Western analysis using anti-IPO13 and anti-HA antibodies. (B) Immobilized GR retains endogenous IPO13 from a HeLa cell lysate. GST-GR purified from E. coli was immobilized on glutathione-Sepharose beads and incubated with lysate from HeLa cells that expressed endogenous only or endogenous plus transfected IPO13. The bound proteins were eluted with SDS-PAGE sample buffer and subjected to Western analysis. Endogenously expressed IPO13 was detected in lysates from both transfected and untransfected cells. An anti-HA antibody was used to detect transfected IPO13-HA. (C and D) Transfected IPO13 interacts in vivo with GR and GRNL1. Lysates from cells cotransfected with constructs for expression of either IPO13-HA or CIPO13-EYFP together with either GR-EGFP or GRNL1-EGFP were immunoprecipitated using an anti-HA or an anti-EGFP antibody. Western blot analysis of precipitated proteins was used to detect the interaction between full-length and C-terminal IPO13 proteins with GR and GRNL1.

 
IPO13 Coimmunoprecipitates with GR
To assess the interaction of IPO13 with GR in vitro, we carried out coimmunoprecipitation experiments after cotransfection of HeLa cells with pIPO13-HA or pCIPO13-EYFP together with pEGFP-GR. An anti-GR antibody was used to immunoprecipitate GR. We then used Western blot analysis to demonstrate coimmunoprecipitation of IPO13-HA or its C-terminal fragment, C-terminal IPO13-EYGFP (Figure 2C). Similarly, after immunoprecipitation of IPO13-HA, Western blot analysis was used to demonstrate coimmunoprecipitation of EGFP-GR. These findings provide evidence for an interaction of both full-length IPO13 and its C-terminal region with GR. Interestingly, IPO13 also bound GRNL1 (Figure 2D), a GR mutant in which lysine residues 513–515 were replaced by asparagines. This substitution has been previously reported to abolish GR NL1 activity in mammalian cells and compromises binding of GR to importin {alpha} (10, 11).

Silencing of IPO13 Prevents Nuclear Import of GR
To begin to investigate the impact of IPO13 on nuclear import of GR in the lung, we next asked whether inhibition of IPO13 expression would influence nuclear localization of GR in A549 cells. To this end, we designed two siRNA duplexes that specifically targeted the 5'and 3' ends of the coding sequence of IPO13. The nucleocytoplasmic distribution of IPO13 in A549 cells is illustrated in Figure 3A. After transient expression of HA-tagged IPO13 (pIPO13-HA) in A549 cells, HA-tagged IPO13 protein was detected diffusely in both the nucleus and the cytoplasm, but not in the nucleolus. Transient expression of IPO13 siRNA constructs would be expected to suppress endogenous IPO13 protein expression. A549 cells were triple-transfected with (1) pIPO13-HA, (2) psiIPO13-5', psiIPO13-3', or psiIPO13-control (a scrambled sequence), and (3) pEYFP (a marker for transfection). Both psiIPO13-5' and psiIPO13-3' specifically silenced expression of IPO13-HA protein (Figure 3B, a–d) when compared to psiRNA-IPO13-control-transfected cells (Figure 3B, e, f). We then used the anti-IPO13 antibody to demonstrate suppression of endogenous IPO13 protein after transfection of A549 cells psiIPO13-5'or psi-IPO13-3' (Figure 3C, a–d). By comparison, no effect on endogenous IPO13 expression was observed after transfection of scrambled IPO3 siRNA sequence (psiControl, Figure3C, e, f), an siRNA directed against GAPDH (Figure 3C g, h) or an empty vector (Figure 3C, i, j). No IPO13 immunostaining was apparent in the absence of IPO13 antibody (Figure 3C k,l). In the presence of an IPO13 siRNA, the percent of cells that expressed IPO13 was reduced by >70% (Figure 3D, three experiments, a minimum of n = 10 cells/experiment; P < 0.001). To confirm that IPO13 functions as a nuclear transporter of GR in normal airway epithelium, we next analyzed the effects of IPO13 RNA interference in PN7epi cells (Figure 3E). The anti-IPO13 antibody was used to demonstrate suppression of endogenous IPO13 protein after transfection of PN7epi cells with psiIPO13-5'or psi-IPO13-3' (Figure 3E, a–d). By comparison, no effect on endogenous IPO13 expression was observed after transfection of scrambled IPO3 siRNA sequence (psiControl, Figure 3E, e, f), or an empty vector (Figure 3E, g, h).


Figure 3
View larger version (61K):
[in this window]
[in a new window]
 
Figure 3. Silencing of IPO13 in A549 and PN7epi cells. (A) Nucleocytolasmic distribution of IPO13 after transfection of A549 cells with pIPO13-HA. Cells were stained using a monoclonal anti-HA antibody and sequentially labeled with RITC-conjugated secondary antibody. As shown, IPO13 protein is concentrated in the nucleus, present in the cytoplasm, but absent in nucleoli. (B) Silencing of transfected IPO13 in A549 cells. Plamsids psiIPO13-5' or psiIPO13-3' were cotransfected with pIPO13-HA and pEYFP into A549 cells. After 24 h, cells were fixed, quenched, and permeabilized. The green fluorescence identifies transfected cells (with either an IPO13 siRNA or scrambled oligonucleotide sequence). The red color indicates the expression of IPO13-HA protein. As shown in a, b, c, and d, IPO13 siRNAs specifically inhibit expression of IPO13 protein. By contrast, scrambled oligonucleotides did not affect the expression of IPO13 (e, f). (C) Silencing of endogenous IPO13 in A549 cells. The plasmids psiIPO13-5', psiIPO13-3', psiControl, psiGAPDH, or pSilencer1.0-U6 were cotransfected with pEYFP into A549 cells. After 24 h, cells were fixed, quenched, and permeabilized. The green fluorescence identifies transfected cells. The red color indicates the expression of IPO13 protein as detected with the IPO13 antibody. As shown in a, b, c, and d, IPO13 siRNAs specifically inhibit expression of IPO13 protein. By contrast, no effect on IPO13 expression was observed after transfection of a scrambled IPO13 siRNA sequence (e, f), an siRNA directed against GAPDH (g, h), or an empty vector (i, j). In the absence of anti-IPO13 antibody, no IPO13 staining is observed (k, l). (D) Quantitation of transfected cells. The IPO13 siRNA inhibited expression of endogenous IPO13 in 70% of cells. (E) Silencing of endogenous IPO13 in PN7epi cells. The plasmids psiIPO13-5', psiIPO13-3', psiControl, or pSilencer1.0-U6 were cotransfected with pEYFP into rat PN7epi cells. After 24 h, cells were fixed, quenched, and permeabilized. The green fluorescence identifies transfected cells. The red color indicates the expression of IPO13 protein as detected with the IPO13 antibody. As shown in a, b, c, and d, IPO13 siRNAs specifically inhibit expression of IPO13 protein. By contrast, no effect on IPO13 expression was observed after transfection of a scrambled IPO13 siRNA sequence (e, f), or an empty vector (g, h).

 
Having established the efficacy of the IPO13 siRNAs, we next investigated the effect of silencing endogenous IPO13 on subcellular localization of GR. After cotransfection with psiIPO13-5' or psiIPO13-3' and the marker plasmid pEYFP, A549 cells were analyzed for endogenous GR localization by immunostaining. As illustrated in Figure 4A (a–d), both IPO13 siRNAs efficiently prevented nuclear entry of GR. By comparison, no effect on nuclear import of GR was observed after transfection of an empty vector (Figure 4A, i, j), a scrambled IPO3 siRNA sequence (psiIPO13-control, Figure 4A, e, f), or an siRNA directed against GAPDH (Figure 4A, g, h). In the presence of the IPO13 siRNA, the percent of cells in which GR was localized to the nucleus was reduced by 75% (Figure 4B; three3 experiments, a minimum of n = 10 cells/experiment; P < 0.001). Similarly, transfection of IPO13 siRNAs (Figure 4C, a–d), but not of scrambled or vector sequences (Figure 4C, e–h), efficiently prevented nuclear translocation of GR in PN7epi cells.


Figure 4
View larger version (61K):
[in this window]
[in a new window]
 
Figure 4. Silencing of IPO13 prevents nuclear import of endogenous GR in A549 and PN7epi cells. (A) Plasmids psiIPO13 (5' and 3'), psiIPO13-control, psiGAPDH, or pSilencer1.0-U6 were cotransfected with pEYFP plasmid DNA into A549 cells. After 24 h, cells were washed in DMEM to remove serum and reincubated in DMEM with 10% charcoal-treated FBS overnight, and 10–5 M cortisol was added for another 1~2 h before fixation. The red color indicates endogenous GR labeled by immunostaining. The green color identifies transfected cells. As shown in a, b, c, and d, IPO13 siRNA prevented the nuclear import of endogenous GR. By contrast, no effect on nuclear import of GR was observed after transfection of a scrambled siRNA sequence (e, f), an siRNA directed against GAPDH (g, h), or an empty vector (i, j). (B) Quantitation of transfected cells with nuclear accumulation of endogenous GR in the presence of cortisol. IPO13 siRNA blocked the nuclear import of endogenous GR in about 75% of cells. (C). Plasmids psiIPO13 (5' and 3'), psiIPO13-control, or pSilencer1.0-U6 were cotransfected with pEYFP plasmid DNA into PN7epi cells. After 24 h, cells were washed in DMEM to remove serum and reincubated in DMEM with 10% charcoal-treated FBS overnight, and 10–5 M cortisol was added for another 1~2 h before fixation. The red color indicates endogenous GR labeled by immunostaining. The green color identifies transfected cells. As shown in a, b, c, and d, IPO13 siRNA prevented the nuclear import of endogenous GR. By contrast, no effect on nuclear import of GR was observed after transfection of a scrambled siRNA sequence (e, f) or an empty vector (g, h).

 
IPO8 has been shown to directly bind GR (11); however, recombinant IPO8 did not potentiate import of GR in the presence of a HeLa cell extract in vitro (11). To confirm the specificity of IPO13 in mediating GR import in A549 cells, we asked whether inhibition of IPO8 expression would influence nuclear localization of GR in this system. Initially, immunofluorescence analysis after transient expression of HA-tagged IPO8 (pIPO8-HA) was used to analyze subcellular localization of IPO8 in A549 cells. Like IPO13, after 24-hr expression, IPO8 was detected diffusely in both the nucleus and the cytoplasm, but not in the nucleolus (Figure 5A). We then designed an siRNA duplex that specifically targeted the coding sequence of IPO8. A549 cells were triple transfected with (1) pIPO8-HA, (2) psiIPO8, or psiControl and (3) pEYFP (a marker for transfection). The IPO8 siRNA specifically silenced expression of IPO8-HA protein (Figure 5B, a, b) when compared to psiControl (Figure 5B, c, d). However, in contrast to the observed effects of IPO13 RNA interference on nuclear import of GR, no significant effect on nuclear import of GR was observed when A549 cells were transfected with psiIPO8 (Figure 5C, a–h, and Figure 5D).


Figure 5
View larger version (62K):
[in this window]
[in a new window]
 
Figure 5. Silencing of IPO8 does not interfere with nuclear import of endogenous GR in A549 cells. (A) Nucleocytoplasmic distribution of IPO8 after transfection of A549 cells with pIPO8-HA. Cells were stained using a polyclonal anti-HA antibody and sequentially labeled with an RITC-conjugated secondary antibody. As shown, IPO8 protein is concentrated in the nucleus, present in the cytoplasm, but absent in nucleoli. (B) Silencing of IPO8 in A549 cells. The plasmid pSiIPO8 was cotransfected with pIPO8-HA and pEYFP into A549 cells after 24 h, cells were fixed, quenched. and permeabilized. The green fluorescence identifies transfected cells (with IPO8 siRNA or scrambled oligonucleotide sequences). The red color indicates the expression of IPO8-HA protein. As shown in a and b, IPO8 siRNA specifically inhibits expression of IPO8 protein. By contrast, scrambled oligonucleotides did not effect the expression of IPO8 (c, d). (C) Silencing of IPO8 does not prevent the nuclear import of GR. Plasmids pSiIPO8, pSiIPO8-control, pSiGAPDH, or pSilencer1.0-U6 were cotrans- fected with pEYFP into A549 cells. After 24 h, cells were washed in DMEM to remove serum and reincubated in DMEM with 10% charcoal-treated FBS overnight, and 10–5 M cortisol was added for another 1~2 h before fixation. The red color indicates endogenous GR labeled by immunostaining. The green color identifies transfected cells. As shown in a and b, the IPO8 siRNA did not prevent the nuclear import of endogenous GR. As expected, no effect on nuclear import of GR was observed after transfection of a scrambled siRNA sequence (c, d), an siRNA directed against GAPDH (e, f), or an empty vector (g, h). (D) Quantitation of transfected cells with nuclear accumulation of endogenous GR in the presence of cortisol. No significant inhibition of nuclear import of endogenous GR was observed in the presence of siIPO8 compared with cells transfected with any of the control plasmids.

 
Silencing of IPO13 Inhibits GC Suppression of the Inflammatory Agent IL-8 in the Presence of TNF-{alpha}
GCs inhibit release of cellular cytokines and have been shown to suppress IL-8 gene expression in cultured airway epithelial cells (16). The proinflammatory cytokine TNF-{alpha} potently stimulates airway epithelial cells to produce cytokines, including IL-8 (17), an effect inhibited by GC. To begin to elucidate the functional consequences of cytoplasmic retention of GR on inflammatory cytokine expression in airway epithelium, we transfected psiRNA-IPO13-5' into A549 cells, stimulated cells with TNF-{alpha}, and examined the effect of TNF-{alpha} stimulation on cellular IL-8 in the presence/absence of cortisol. The effects of TNF-{alpha} and cortisol on A549 cells in culture are illustrated in Figure 6A. In the absence of TNF-{alpha}, no effect on IL-8 expression was seen when cells were pretreated with cortisol (Figure 6A, c). TNF-{alpha} clearly stimulated IL-8 expression in A549 cells (Figure 6A, b) when compared to untreated controls (Figure 6A, a). Incubation in the presence of 10–7–10–5 M cortisol or 10–7 M Dex effectively suppressed TNF-{alpha} stimulation of IL-8 expression (Figure 6A, d and data not shown).


Figure 6
View larger version (69K):
[in this window]
[in a new window]
 
Figure 6. Silencing of IPO13 inhibits GC suppression of IL-8 in the presence of TNF-{alpha} in airway epithelial A549 cells. (A) GC inhibits the TNF-{alpha}–mediated upregulation of IL-8 in A549 cells. A549 cells were treated with TNF-{alpha} (10 ng/ml, 3 h), cortisol (10–5 M, 1 h), or both. In the absence of cortisol, TNF-{alpha} stimulated the expression of IL-8 (b). Preincubation of cells in 10–5 M cortisol for 1 h suppressed TNF-{alpha} stimulation of IL-8 expression (d). Endogenous IL-8 was detected by a monoclonal antibody. (BE) Suppression of IL-8 in the presence of TNF-{alpha} and/or GC in airway epithelial A549 cells. Cells were seeded on coverslips in DMEM plus 10% decomplemented FBS. After overnight culture, 0.2 µg/coverslip of siIPO13-5' or siControl vector was cotransfected with an equal amount of pCMV-HA plasmid. After 4- to 5-h incubation, cells were washed in DMEM and reincubated in DMEM with 10% charcoal-treated FBS overnight, and 10–5 M cortisol (final concentration) was added for 1 h, followed by 10 ng/ml TNF-{alpha} for an additional 3 h. Cells were then fixed and stained with a monoclonal mouse anti-human IL-8 antibody combined with a polyclonal rabbit anti-HA antibody. Transfected cells were detected by HA expression. A slight (but not significant) increase in cellular levels of IL-8 was observed in IPO13 siRNA-transfected cells (B) when compared with cells transfected with a control siRNA. In the presence of 10–5 M cortisol, IPO13-5' siRNA-transfected cells exhibited a moderate increase in IL-8 expression relative to control siRNA-transfected cells (C). An increase in IL-8 was observed, as expected, in both psiIPO13-5' and psiControl-transfected cells in the presence of TNF-{alpha} (D). (E) The impact of cortisol on TNF-{alpha} stimulation of IL-8 production in psiPO13-5' or psiControl-transfected cells. Note that the presence of the IPO13-5' siRNA clearly inhibited the ability of cortisol to suppress TNF-{alpha}–stimulated IL-8 expression. (F) Relative IL-8 fluorescence in siIPO13-transfected cells compared to controls in the presence/absence of GC and TNF{alpha}. *P < 0.001 compared with cells without TNF-{alpha} or GC; #P < 0.001 compared with cells with TNF-{alpha} or GC.

 
We next cotransfected A549 cells with the psiIPO13-5' (or psiControl) and the marker plasmid pCMV-HA. Cells were grown in complete medium (4–5 h) before transfer to hormone-free medium overnight. Cells were then treated with cortisol for 1 h, followed by TNF-{alpha} for 3 h. The effects of cortisol and/or TNF-{alpha} treatment on IL-8 levels in the presence/absence of a transfected IPO13 SiRNA are shown in Figures 6B–6E. Immunostaining with an anti-HA antibody was used to identify transfected cells in all cases.

Little or no change in cellular levels of IL-8 was observed in IPO13 siRNA-transfected cells when compared to cells transfected with a control siRNA (Figure 6B). A detectible but nonsignificant elevation in IL-8 levels observed occasionally (Figure 6F) may have resulted from the effects of silencing IPO13 on nuclear import of endogenous GR. In the presence of cortisol, IPO13 siRNA-transfected cells exhibited a moderate increase in IL-8 expression relative to IPO13-control siRNA-transfected cells (Figures 6C and 6F). These findings are consistent with an association between the effects of the IPO13 siRNA in preventing nuclear entry of endogenous GR and the disruption of the ability of GCs to suppress expression of the inflammatory cytokine IL-8.

The effects of TNF-{alpha} in stimulating IL-8 production in A549 cells transfected with psiIPO13, in the absence of cortisol, are shown in Figure 6D. An increase in IL-8 is observed, as expected, in both psiIPO13 (Figure 6D) and psiControl transfected cells.

The impact of cortisol on TNF-{alpha} stimulation of IL-8 production in psiIPO13 or psiControl transfected cells is illustrated in Figure 6E. Note that the presence of the IPO13 siRNA inhibited the ability of cortisol to suppress TNF-{alpha}–stimulated IL-8 expression. Figure 6F illustrates the relative IL-8 fluorescence in siIPO13-transfected cells compared to control cells after incubation in the presence of TNF-{alpha}, GC, or both (three experiments, n = 10 cells/experiment; P < 0.001). TNF-{alpha} strongly stimulated IL-8 in siControl-transfected cells, an effect that was abrogated in the presence of GC (10–5 M). By contrast, GC had no significant effect in reducing IL-8 levels after TNF-{alpha} exposure in siIPO13-5'-treated cells.


    DISCUSSION
 Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Administration of glucocorticoids to patients with asthma, either parenterally or directly to the airways, has profound antiinflammatory effects due to their ability to alter the expression of many proinflammatory genes. Variation in the expression and/or function of GR, proteins that interact with GR, or target proteins regulated by GCs would therefore be expected to impact steroid responsiveness. Our findings suggest that IPO13 may fall into the category of proteins that impact steroid responsiveness via regulation of nuclear import of GR.

IPO13 was identified in a search for GC-responsive genes in late-gestation lung (12). We then showed that nucleocytoplasmic shuttling of IPO13 was differentially regulated in lung fibroblasts during the saccular/alveolar stages of development (13). To begin to address whether variable IPO13 shuttling rates impact lung maturation, we sought to identify potential cargo substrates that might be important in the process of alveolarization. We hypothesized that, as in the case of other importin beta proteins, the IPO13 C-terminal fragment would include the cargo-binding region. To test this hypothesis we expressed full-length, N-terminal or C-terminal IPO13 protein in HeLa cells. The cytoplasmic retention of GR in 70–80% of HeLa cells after transfection of C-terminal IPO13 was consistent with a role for IPO13 in GR nuclear import. Protein pull-down, coimmunoprecipitation, and RNA interference studies provide additional compelling evidence that IPO13 mediates transport of GR in both HeLa and airway epithelial cells.

Transport through the nuclear pore complex of most proteins is mediated by members of the family of evolutionarily conserved transport factors, the importin beta (also called karyopherin beta) family (18). Importin betas target import substrates by interacting with cognate NLS. The transport of various NLS-bearing substrates is mediated by different members of the importin beta family. The import of a subset of nuclear proteins is initiated by interaction of an importin {alpha} adaptor protein with specific NLSs comprised of closely spaced arrangements of five to eight basic aa (such as GR NL1) (18), which colocalize with DNA binding domains of cargo substrates. Many importin beta proteins, however, bind directly to cargoes, and do not rely on an adaptor. NLS recognition sites for these importin betas are less well characterized. Our initial comparison of IPO13 (lgl2) with sequences in the genome database had shown that it was most closely related to importin beta family members, which were known to interact directly with specific NLS substrates (12). We therefore predicted that it too would form a binding complex with cargo substrates in the absence of an adapter protein.

The finding that IPO13 coimmunoprecipitated with a GR NL1 mutant (GRNL1) that compromises binding of GR NL1 to importin {alpha}, IPO7, and IPO8 (10, 11) and abolishes NL1 activity in mammalian cells (10) is of interest. IPO13 may interact with a region of GR other than GR NL1, or perhaps with more than one region of GR. Indeed, Freedman and Yamamoto recently demonstrated that IPO7 and IPO8 bound both NL1 and NL2 of GR, whereas importin {alpha} bound only GR NL1. Furthermore, in an in vitro import assay, they showed that importin {alpha}/beta and IPO7, but not IPO8, supported import of full-length GR. It is not known whether IPOs 7 or 8 interact with more than one site on GR simultaneously—or how such binding might influence nuclear import. But it is reasonable to speculate that tissue and developmental specificity of import receptor expression and receptor–cargo interactions modulate efficiency of tissue-specific nuclear import of GR. Evidence to date suggests that nuclear import of GR is likely accomplished by multiple transport proteins. Individual import receptors may mediate GR translocation after activation by cell-specific signals. The results reported here are consistent with an important role for IPO13 in regulating nuclear import of GR in airway epithelium.

Several previous studies have reported on cargo substrates for IPO13. Mingot and colleagues (19) reported that IPO13 acts as an import factor for SUMO/sentrin–conjugating enzyme, UBC9, and for MGN (a protein important in Drosophila embryogenesis). Ploski and colleagues showed that IPO13 mediated nuclear import of Pax family proteins (Pax6, Pax3, and Crx) (20). Most recently, Kahle and colleagues demonstrated that the NF-YB/NF-YC heterodimer of the CCAAT box–specific NF-Y transcription factor (also known as CBF) is imported by IPO13 (21).

Pax6 is considered to be a master switch for ocular morphogenesis (22). Pax3 is a regulator of neurogenic and myogenic embryogenesis (23). Crx is involved in photoreceptor differentiation and development (24). NF-Y–mediated transcription is required in higher eukaryotes for cell proliferation and viability, and homozygous deletion of NF-Y in mice is associated with early embryonic lethality (25). These studies establish a role of IPO13 as a nuclear transport factor important in developmental processes. Whether developmentally regulated nuclear transport via IPO13 is determined by sequences within the IPO13 protein or dependent on cargo substrates (such as GR, PAX, or NF-Y), which may themselves be developmentally regulated, is as yet undetermined. GC-GR signaling modulates multiple aspects of lung development. It will be important to delineate the role of IPO13 in modulating specific GC-GR signaling events in lung development.

The correct nuclear concentration of developmentally important factors can be critical to normal development; and, by implication, the time-specific disruption of adequate nuclear import may contribute to disease phenotypes. To date, there is no known disease causing mutations in nuclear transport receptors, underscoring, perhaps, the essential nature of nuclear trafficking in eukaryotic cells. It may well be, however, that effects on nuclear translocation of specific cargo substrates, can contribute to disease phenotypes. At least one aniridia-causing Pax6 mutation has been shown to disrupt Pax6 nuclear transport in COS-7 cells (26). Disease-causing mutations in Crx have been shown to affect nuclear import (27). It will be important to determine whether genetic variants of IPO13 are associated with aberrant developmental processes in the lung that may contribute to neonatal or adult lung pathologies.

Aberrant nuclear translocation of GR is also likely to contribute to the therapeutic potential of GC in disorders such as asthma and COPD. Indeed, Matthews and colleagues recently reported on defective GR translocation in peripheral bone marrow cells of steroid-resistant patients with asthma (28). The inability of inhaled GCs to regulate cytokine levels and redress protease–antiprotease imbalance in patients with COPD has been associated with oxidative stress (3, 29), which has been suggested to impair nuclear import of GR (30). Taken together, these findings suggest that GR-mediated steroid response is likely to be subject to multifactorial regulation via both genetic and environmental influences.

A question that is raised in the analysis of the potential effects of IPO13 in the airways on GC-GR–modulated gene transcription is that of cellular levels and the influence of hGRbeta. In this study, we assessed the effects of IPO13 on GR import in two cell lines and in primary lung cell culture. Given that only hGR{alpha} is present in the cytoplasm of these cells in significant concentrations, we do not expect that hGRbeta will function as a competitive inhibitor for import. The expression of hGRbeta mRNA and protein have been reported to be exceedingly low when compared with that of the hGR{alpha} isoform in human respiratory epithelial cells, including A549 cells (31). Interestingly, recent studies provide evidence for reduced nuclear translocation of hGR{alpha} in response to steroids in bronchoalveolar lavage (BAL) cells from patients with GC-insensitive asthma (8). Increased levels of cytosolic hGRbeta in BAL macrophages from these patients suggest that impaired nuclear translocation of GR may be hGRbeta-induced.

An improved understanding of the role of developmentally important transcription and growth factors in lung physiology and pathobiology has emerged in the last decade. Existing evidence supports roles for Nkx2.1 (32), TNF-{alpha} (33), and NF-{kappa}B (34) in both morphogenetic and pathologic events in the lung. GR, an important modulator of lung organogenesis and maturation, is also an important regulator of inflammatory response in the lung. Our findings suggest that IPO13 may exemplify an additional class of molecular regulators, the nuclear trafficking proteins, as modulators of both lung development and lung disease.

The antiinflammatory activity of GC, mediated via activation of GR in virtually all living cells, is likely to involve altered transcription of multiple genes (3). Important among these, perhaps most important, is the ability of GC to inhibit transcription of cytokine and chemokine genes implicated in asthmatic inflammation. The bronchial epithelium is ideally situated to modulate inflammatory events in the airways. Bronchial epithelial cells have the potential to be a major source of IL-8 and other cytokines, and cytokine production can be amplified by TNF-{alpha} (17).

Where might IPO13 fit into this picture? A small percentage of patients with asthma are GC-resistant, and fail to respond to even high doses of GC. Mechanisms that may contribute to GC resistance include: (1) downregulation of the receptor level induced by GR; (2) dominant negative influence of hGRbeta; and (3) repression by the transcription factor NF-{kappa}B (Figure 7) (4). Indeed, GC resistance is likely to reflect multifactorial effects, and each of these mechanisms may come into play in a subset of GC-resistant patients. For example, in one study involving 33 subjects with asthma, Gagliardo and colleagues (35) demonstrated that persistent release of IL-8 in GC-dependent asthma is not associated with low expression of hGR{alpha} or overexpression of hGRbeta. Others have shown that GR mRNA and protein expression in bronchial biopsies and epithelial cell brushings appear to be unchanged in patients with asthma and those with COPD compared with normal subjects (2, 36, 37), suggesting that levels of GR are unlikely to be a major contributing factor in GC resistance at least in a subset of GC-resistant patients.


Figure 7
View larger version (35K):
[in this window]
[in a new window]
 
Figure 7. Mechanisms of glucocorticoid resistance. Four mechanisms that may contribute to GC resistance are indicated: hGR{alpha}-induced downregulation, hGRbeta-induced inhibition, repression by NF-kbeta (4), and deficient GR nuclear import.

 
To this list of potential mechanisms of GC resistance, we suggest the addition of another potential mechanism involving dysregulation of IPO13-mediated nuclear import of GR (Figure 7) via altered concentration of IPO13 or altered IPO13 shuttling activity. Comparison of IPO13 levels and nucleocytoplasmic shuttling potential in cells from normal individuals and GC-sensitive and GC-resistant patients with asthma will be required to determine whether IPO13 plays a significant role in GC resistance. Indeed, the recent demonstration that elevated cytosolic levels of hGRbeta in BAL cells from GC-insensitive patients with asthma associates with impaired nuclear entry of GR provides a potential mechanism for hGRbeta-induced dominant negative interference. We speculate that high concentrations of hGRbeta in these patients may compete for binding to nuclear transport carriers such as IPO13. An increased understanding of how GCs act in regulating the pathophysiology of inflammatory diseases, such as asthma and COPD, and, more specifically, an improved understanding of the role of IPO13 in regulating GR-mediated cytokine levels, may open new opportunities for development of therapeutic agents for treatment of chronic inflammatory disease.


    Acknowledgments
 
The authors thank Neil B. Sweezey for valuable discussions related to IPO13 research, and Katia Nadeau, Leslie Ribeiro, and Isabel Mandeville for reviewing the manuscript.


    Footnotes
 
T.T. and J.L. contributed equally to this work.

* Current affiliation: Key Laboratory for Cell Biology and Tumor Cell Engineering, Ministry of Education of China, Xiamen University School of Life Sciences, Xiamen, Fujian, China. Back

This work was supported by grants from the Canadian Institutes of Health Research (F.K.) and a Montreal Children's Hospital Research Institute Postdoctoral Fellowship Award (T.T.).

This article has an online supplement, which is accessible from this issue's table of contents at www.atsjournals.org

Originally Published in Press as DOI: 10.1165/rcmb.2006-0073OC on July 29, 2006

Conflict of Interest Statement: None of the authors has a financial relationship with a commercial entity that has an interest in the subject of this manuscript.

Received in original form February 16, 2006

Accepted in final form May 12, 2006


    References
 Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 

  1. Necela B, Cidlowski J. Mechanisms of glucocorticoid receptor action in noninflammatory and inflammatory cells. Proc Am Thorac Soc 2004;1:239–246.[Free Full Text]
  2. Adcock IM. Molecular mechanisms of glucocorticosteroid actions. Pulm Pharmacol Ther 2000;13:115–126.[CrossRef][Medline]
  3. Adcock I, Ito K, Barnes P. Glucocorticoids: effects on gene transcription. Proc Am Thorac Soc 2004;1:247–254.[Abstract/Free Full Text]
  4. Schaaf MJ, Cidlowski JA. Molecular mechanisms of glucocorticoid action and resistance. J Steroid Biochem Mol Biol 2003;83:37–48.
  5. Zhou J, Cidlowski JA. The human glucocorticoid receptor: one gene, multiple proteins and diverse responses. Steroids 2005;70:407–417.[CrossRef][Medline]
  6. Yudt MR, Jewell CM, Bienstock RJ, Cidlowski JA. Molecular origins for the dominant negative function of human glucocorticoid receptor beta. Mol Cell Biol 2003;23:4319–4330.[Abstract/Free Full Text]
  7. Bamberger CM, Bamberger AM, de Castro M, Chrousos GP. Glucocorticoid receptor beta, a potential endogenous inhibitor of glucocorticoid action in humans. J Clin Invest 1995;95:2435–2441.[Medline]
  8. Goleva E, Li LB, Eves PT, Strand MJ, Martin RJ, Leung DYM. Increased glucocorticoid receptor beta alters steroid response in glucocorticoid-insensitive asthma. Am J Respir Crit Care Med 2006;173:607–616.[Abstract/Free Full Text]
  9. Picard D, Yamamoto KR. Two signals mediate hormone-dependent nuclear localization of the glucocorticoid receptor. EMBO J 1987;6:3333–3340.[Medline]
  10. Savory JGA, Hsu B, Laquian IR, Giffin W, Reich T, Hache RJG, Lefebvre YA. Discrimination between NL1- and NL2-mediated nuclear localization of the glucocorticoid receptor. Mol Cell Biol 1999;19:1025–1037.[Abstract/Free Full Text]
  11. Freedman N, Yamamoto K. Importin 7 and importin {alpha}/importin beta are nuclear import receptors for the glucocorticoid receptor. Mol Biol Cell 2004;15:2276–2286.[Abstract/Free Full Text]
  12. Zhang C, Sweezey NB, Gagnon S, Muskat B, Koehler D, Post M, Kaplan F. A novel karyopherin-beta homolog is developmentally and hormonally regulated in fetal lung. Am J Respir Cell Mol Biol 2000;22:451–459.[Abstract/Free Full Text]
  13. Tao T, Lan J, Presley J, Sweezey N, Kaplan F. Nucleocytoplasmic shuttling of lgl2 is developmentally regulated in fetal lung. Am J Respir Cell Mol Biol 2004;30:350–359.[Abstract/Free Full Text]
  14. Kaplan F, Ledoux P, Kassamali FQ, Gagnon S, Post M, Koehler D, Deimling J, Sweezey NB. A novel developmentally regulated gene in lung mesenchyme: homology to a tumor-derived trypsin inhibitor. Am J Physiol Lung Cell Mol Physiol 1999;276:L1027–L1036.[Abstract/Free Full Text]
  15. Schaaf MJ, Cidlowski JA. Molecular determinants of glucocorticoid receptor mobility in living cells: the importance of ligand affinity. Mol Cell Biol 2003;23:1922–1934.[Abstract/Free Full Text]
  16. Chang M, Juarez M, Hyde DM, Wu R. Mechanism of dexamethasone-mediated interleukin-8 gene suppression in cultured airway epithelial cells. Am J Physiol Lung Cell Mol Physiol 2001;280:L107–L115.[Abstract/Free Full Text]
  17. Kwon OJ, Au BT, Collins PD, Adcock IM, Mak JC, Robbins RR, Chung KF, Barnes PJ. Tumor necrosis factor-induced interleukin-8 expression in cultured human airway epithelial cells. Am J Physiol 1994;267: L398–L405.[Medline]
  18. Pemberton L, Paschal B. Mechanisms of receptor-mediated nuclear import and nuclear export. Traffic 2005;6:187–198.[CrossRef][Medline]
  19. Mingot J-M, Kostka S, Kraft R, Hartmann E, Gorlich D. Importin 13: a novel mediator of nuclear import and export. EMBO J 2001;20:3685–3694.[CrossRef][Medline]
  20. Ploski JE, Shamsher MK, Radu A. Paired-type homeodomain transcription factors are imported into the nucleus by karyopherin 13. Mol Cell Biol 2004;24:4824–4834.[Abstract/Free Full Text]
  21. Kahle J, Baake M, Doenecke D, Albig W. Subunits of the heterotrimeric transcription factor NF-Y are imported into the nucleus by distinct pathways involving importin beta and importin 13. Mol Cell Biol 2005;25: 5339–5354.[Abstract/Free Full Text]
  22. Gehring WJ. The master control gene for morphogenesis and evolution of the eye. Genes Cells 1996;1:11–15.[Abstract]
  23. Mansouri A. The role of Pax3 and Pax7 in development and cancer. Crit Rev Oncog 1998;9:141–149.[Medline]
  24. Furukawa T, Morrow E, Cepko C. Crx, a novel otx-like homeobox gene, shows photoreceptor-specific expression and regulates photoreceptor differentiation. Cell 1997;91:531–541.[CrossRef][Medline]
  25. Bhattacharya A, Deng JM, Zhang Z, Behringer R, de Crombrugghe B, Maity SN. The B subunit of the CCAAT box binding transcription factor complex (CBF/NF-Y) is essential for early mouse development and cell proliferation. Cancer Res 2003;63:8167–8172.[Abstract/Free Full Text]
  26. Glaser T, Walton D, Cai J, Epstein J, Jepeal L, Maas RL. Pax mutations in aniridia. In: Wiggs JR, editor. Molecular genetics of ocular disease. New York: Wiley-Liss Inc.; 1995. pp. 51–82.
  27. Fei Y, Hughes T. Nuclear trafficking of photoreceptor protein Crx: the targeting sequence and pathologic implications. Invest Ophthalmol Vis Sci 2000;41:2849–2856.[Abstract/Free Full Text]
  28. Matthews J, Ito K, Barnes P, Adcock I. Defective glucocorticoid receptor nuclear translocation and altered histone acetylation patterns in glucocorticoid-resistant patients. J Allergy Clin Immunol 2004;113: 1100–1108.[CrossRef][Medline]
  29. Culpitt SV, Maziak W, Loukidis S, Nightingale JA, Matthews JL, Barnes PJ. Effect of high dose inhaled steroid on cells, cytokines, and proteases in induced sputum in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 1999;160:1635–1639.[Abstract/Free Full Text]
  30. Okamoto K, Tanaka H, Ogawa H, Makino Y, Eguchi H, Hayashi S, Yoshikawa N, Poellinger L, Umesono K, Makino I. Redox-dependent regulation of nuclear import of the glucocorticoid receptor. J Biol Chem 1999;274:10363–10371.[Abstract/Free Full Text]
  31. Pujols L, Mullol J, Perez M, Roca-Ferrer J, Juan M, Xaubet A, Cidlowski JA, Picado C. Expression of the human glucocorticoid receptor {alpha} and beta isoforms in human respiratory epithelial cells and their regulation by dexamethasone. Am J Respir Cell Mol Biol 2001;24:49–57.[Abstract/Free Full Text]
  32. Stahlman MT, Gray ME, Whitsett JA. Expression of thyroid transcription factor-1 (TTF-1) in fetal and neonatal human lung. J Histochem Cytochem 1996;44:673–678.[Abstract]
  33. Coker RK, Laurent GJ. Pulmonary fibrosis: cytokines in the balance. Eur Respir J 1998;11:1221.
  34. Muraoka R, Bushdid P, Brantley D, Yull F, Kerr L. Mesenchymal expression of nuclear factor-{kappa}B inhibits epithelial growth and branching in the embryonic chick lung. Dev Biol 2000;225:322–338.[CrossRef][Medline]
  35. Gagliardo R, Chanez P, Vignola AM, Bousquet J, Vachier I, Godard P, Bonsignore G, Demoly P, Mathieu M. Glucocorticoid receptor {alpha} and beta in glucocorticoid dependent asthma. Am J Respir Crit Care Med 2000;162:7–13.[Abstract/Free Full Text]
  36. Adcock IM, Gilbey T, Gelder CM, Chung KF, Barnes PJ. Glucocorticoid receptor localization in normal and asthmatic lung. Am J Respir Crit Care Med 1996;154:771–782.[Abstract]
  37. Vachier I, Chiappara G, Vignola AM, Gagliardo R, Altieri E, Térouanne B, Vic P, Bousquet J, Godard P, Chanez P. Glucocorticoid receptors in bronchial epithelial cells in asthma. Am J Respir Crit Care Med 1998;158:963–970.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
M. M. Pradeepa, S. Manjunatha, V. Sathish, S. Agrawal, and M. R. S. Rao
Involvement of Importin-4 in the Transport of Transition Protein 2 into the Spermatid Nucleus
Mol. Cell. Biol., July 1, 2008; 28(13): 4331 - 4341.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. Hutten, A. Flotho, F. Melchior, and R. H. Kehlenbach
The Nup358-RanGAP Complex Is Required for Efficient Importin {alpha}/{beta}-dependent Nuclear Import
Mol. Biol. Cell, May 1, 2008; 19(5): 2300 - 2310.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supplement
Right arrow All Versions of this Article:
2006-0073OCv1
35/6/668    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions