help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Published ahead of print on November 22, 2006, doi:10.1165/rcmb.2006-0038OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2006-0038OCv1
36/4/504    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Divangahi, M.
Right arrow Articles by Petrof, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Divangahi, M.
Right arrow Articles by Petrof, B. J.
American Journal of Respiratory Cell and Molecular Biology. Vol. 36, pp. 504-512, 2007
© 2007 American Thoracic Society
DOI: 10.1165/rcmb.2006-0038OC

Impact of IL-10 on Diaphragmatic Cytokine Expression and Contractility during Pseudomonas Infection

Maziar Divangahi, Alexandre Demoule, Gawiyou Danialou, Linda Yahiaoui, Weisheng Bao, Zhou Xing and Basil J. Petrof

Meakins-Christie Laboratories and Respiratory Division, McGill University Health Centre, Montreal, Quebec; Centre for Gene Therapeutics, McMaster University, Hamilton, Ontario, Canada; and Université Paris 6 Pierre et Marie Curie, UPRES EA2397, Paris, France

Correspondence and requests for reprints should be addressed to Basil J. Petrof, M.D., Respiratory Division, Room L411, Royal Victoria Hospital, 687 Pine Ave. West, Montreal, PQ, Canada H3A 1A1. E-mail: basil.petrof{at}mcgill.ca


   Abstract
Top
 Abstract
CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Severe weakness of the respiratory muscles, with attendant respiratory failure and death, has been documented in sepsis. In this study, we show that during murine pulmonary infection with Pseudomonas aeruginosa, multiple proinflammatory genes are up-regulated not only within the lungs, but also within the diaphragm. Significant induction of TNF-{alpha}, IL-1{alpha}, IL-1beta, IL-6, and IL-18 gene expression occurred within the diaphragm in a bacterial dose–dependent manner. We determined whether the anti-inflammatory cytokine IL-10 could blunt proinflammatory gene expression within the diaphragm under these conditions. The IL-10 receptor was found to be expressed by the diaphragm in vivo as well as in primary diaphragmatic muscle cell cultures. Transduction of myoblasts with an adenoviral vector (Ad-IL-10) induced strong IL-10 expression, and intramuscular injection of the same vector in vivo produced significant increases in IL-10 serum levels. Ad-IL-10 treatment of mice infected with P. aeruginosa significantly inhibited the induction of proinflammatory cytokines within the diaphragm, but not in the infected lungs. Ad-IL-10 treatment also led to greatly improved diaphragmatic force production in infected mice. These results suggest that pulmonary infection triggers proinflammatory gene expression by the diaphragm along with diaphragmatic weakness. Shifting the balance between pro- and anti-inflammatory mediators in favor of the latter by IL-10 gene delivery was able to restore normal diaphragmatic force-generating capacity under these conditions, suggesting a possible avenue for therapeutic intervention.

Key Words: diaphragm • sepsis • cytokines • interleukin-10 • gene transfer



   CLINICAL RELEVANCE
Top
 Abstract
 CLINICAL RELEVANCE
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
This article provides proof of principle that altering the proinflammatory versus anti-inflammatory cytokine balance in the diaphragm may improve diaphragmatic function in severe pneumonia.

 
The diaphragm is the primary muscle of respiration. Impaired contractility of the diaphragm, leading to respiratory failure and death, is well documented in animal models of sepsis (1). Sepsis is characterized by a systemic inflammatory response of the host to severe infection (2), which is mediated in large part through the production of proinflammatory effector molecules. Respiratory failure is a major clinical manifestation of sepsis, which greatly contributes to the high mortality associated with this condition (3). To date, most investigations of respiratory muscle dysfunction in sepsis have been performed in models involving high-dose endotoxin administration. We have recently reported that severe diaphragmatic weakness also occurs during a more low-grade and sustained form of Gram-negative infection, caused by instillation of Pseudomonas aeruginosa organisms into mouse lungs (4). P. aeruginosa is one of the most common causes of nosocomial pneumonia, and is also a major source of morbidity and mortality in patients with chronic lung diseases such as cystic fibrosis.

There is considerable evidence that diaphragmatic weakness and wasting are induced by a number of proinflammatory mediators, including reactive oxygen species (5), nitric oxide (NO) (6), TNF-{alpha} (7–9), and IL-6 (10). These proinflammatory mediators have the potential to cause muscle weakness via several pathways, such as stimulation of muscle cell protein loss (11, 12), interference with insulin receptor signaling (13), and direct depression of excitation–contraction coupling (14) or myofilament function (15). In addition to such proinflammatory mediators, anti-inflammatory effector molecules are also activated during sepsis. Indeed, the systemic and tissue equilibrium between proinflammatory and anti-inflammatory effector molecules is an important determinant of the final clinical outcome in patients with sepsis (16). IL-10 is probably the most well established of the anti-inflammatory cytokines, and was originally termed cytokine synthesis inhibitory factor (17). IL-10 exerts its anti-inflammatory effects via several complex mechanisms, including inhibition of cytokine expression (18, 19), interference with antigen presentation (20), and suppression of costimulatory molecules (21). In animal models of endotoxemia, IL-10 can inhibit the expression of proinflammatory cytokines such as TNF-{alpha} and IL-6 in the lung and serum (22), as well as reduce mortality (23).

In the present study, we hypothesized that pulmonary infection with P. aeruginosa would lead to significant up-regulation of proinflammatory effector molecules in the diaphragm, and that this would occur in a bacterial dose–dependent manner. In a previous study performed by our group, diaphragmatic contractility was greatly impaired during P. aeruginosa lung infection, whereas limb muscle function was unaffected (4). Therefore, we also postulated that the level of proinflammatory gene expression by the diaphragm would be greater than in the limb muscles under the same conditions of P. aeruginosa infection. Finally, we hypothesized that proinflammatory mediator gene expression by the diaphragm, as well as associated diaphragmatic weakness, could be beneficially modulated by shifting the systemic balance between pro- and anti-inflammatory cytokines in favor of the latter through the use of IL-10 therapy.


   MATERIALS AND METHODS
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 References
 
Animal Model
The model of pulmonary infection with P. aeruginosa employed in this study was performed essentially as described by Starke and colleagues (24), with minor modifications. A mucoid strain of P. aeruginosa (strain 508) was used, which was originally isolated from a patient with cystic fibrosis (25). Briefly, log-phase P. aeruginosa bacteria were concentrated and mixed with 1.5% trypticase soy agar pre-warmed to 52°C. This mixture was added to heavy mineral oil at 52°C and rapidly stirred for 6 min, followed by cooling for 10 min at 4°C. After removing excess oil, the bacteria-bead preparation was washed extensively and resuspended in sterile PBS at pH 7.4. The size (100–150 mm) and uniformity of the beads were verified by light microscopy. In addition, the number of viable bacteria trapped within the agar beads was measured by homogenizing the beads and then plating 10-fold serial dilutions on trypticase soy agar plates. Sterile agar beads were produced in the same manner but with omission of bacteria, and were confirmed to be free of colony-forming units (cfu). To deliver bacteria-containing agar beads to mouse lungs, the mice were first anesthetized with a combination of ketamine (130 mg/kg) and xylazine (20 mg/kg) injected intramuscularly. A small incision was made at the midline of the neck to expose the trachea. The trachea was then intubated with a sterile flexible 22-ga cannula attached to a 1-ml syringe, which was used to inject 50 ml of the agar bead suspension into the lungs. Mice were infected with two different doses of bacteria: 2 x 105 cfu (low dose) and 1 x 106 cfu (high dose).

Studies were performed in 8- to 10-wk-old C57BL/6 mice, which were used in accordance with the guidelines established by the Canadian Council on Animal Care. A total of six experiments involving 119 mice were performed. Outcome measures differed among experiments, but all outcomes were evaluated at 48 h after infection unless otherwise specified. The dosages of P. aeruginosa bacteria employed for inducing lung infection, the time point of evaluation, and the primary limb muscles (soleus and extensor digitorum longus) selected for comparison to the diaphragm were all based upon our previous study, which demonstrated preferential diaphragmatic weakness with high-dose but not low-dose infection under the same conditions (4).

Primary Muscle Cell Culture
Primary diaphragmatic muscle cell cultures were established as previously described (26), using single living muscle fibers to isolate adult myoblast precursors (also known as satellite cells). Briefly, excised diaphragm muscle strips from 8-wk-old mice were subjected to collagenase digestion (0.2% collagenase at 37°C for 60 min), followed by trituration with heat-polished Pasteur pipettes of decreasing bore size to liberate individual fibers. The individual fibers were washed in Dulbecco's modified Eagle's medium (DMEM) and PBS, collected, and then transferred into Matrigel (Becton Dickinson, Franklin Lakes, NJ)-coated (1 mg/ml in DMEM) 6-well plates. All culture media contained 1% penicillin/streptomycin and 0.2% amphotericin B (Invitrogen, Carlsbad, CA). The cultures were maintained in DMEM with 10% horse serum and 0.5% chick embryo extract (MP Biomedical, Aurora, OH) for 4 d, during which myoblasts attached to the substratum. Diaphragmatic myoblasts were then expanded in growth medium (20% fetal bovine serum, 10% horse serum, 1% chick embryo extract in DMEM) until attaining ~ 75% confluence. At this point, the cultures were placed in differentiation medium (2% fetal bovine serum, 10% horse serum, 0.5% chick embryo extract in DMEM) to induce myoblast fusion into differentiated myotubes.

IL-10 Gene Transfer and Measurement of Serum IL-10 Levels
Construction of the recombinant adenoviral vector (Ad5E1 mIL-10), containing the murine IL-10 cDNA driven by the human cytomegalovirus promoter, has been previously described in detail (22). For in vitro transduction studies, primary diaphragmatic myoblasts were expanded in growth medium for 48 h and then transduced with Ad-IL-10 or empty vector contained in DMEM (multiplicity of infection = 20; 3.5 x 107 cells/well) for 4 h. The myoblasts were then washed with PBS and maintained in growth medium for another 24 h before being harvested for RNA extraction.

For in vivo studies, Ad-IL-10 (1 x 108 plaque-forming units [pfu]) was diluted in 100 ml PBS and injected intramuscularly into the hindlimbs (two injection sites per leg, 25 µl per site) at the time of lung infection (22). This method allows for more sustained elevations of IL-10 levels than can be achieved with single injections of recombinant protein, and the vector/gene dosage used in our study was based upon previous work using the same approach in a mouse endotoxemia model (22). Mice injected under identical conditions with an empty adenoviral vector (Ad5 dl70–3), that is, lacking the IL-10 transgene, served as a control group. To quantify serum levels of IL-10, a commercially available ELISA was employed according to manufacturer's instructions (R&D Systems, Minneapolis, MN). Sera were prepared from blood samples obtained by retro-orbital bleeding at Days 0, 1, and 2 after injection of the adenoviral vectors.

IL-10 Receptor Expression
IL-10 receptor (IL-10Ra) mRNA expression by the diaphragm in vivo and in vitro was evaluated by RT-PCR, using total RNA (1 µg) obtained from diaphragm tissues or cultured primary diaphragmatic muscle cells, respectively. RT was performed using M-MLV reverse transcriptase and random primers (Promega, Madison, WI). PCR amplification of the cDNA was performed with primers which span intron one, and consist of the following sequences (5' to 3'): CCCATTCCTCGTCACGATCTC (forward), and TCAGACTGGTTTGGGATAGGTTT (reverse). Amplification was performed for 45 cycles with a denaturation step at 95°C, annealing at 57°C, and extension at 72°C. The resulting PCR product (predicted amplicon size of 141 bp) was visualized on an agarose gel containing ethidium bromide.

Evaluation of Proinflammatory Mediator Expression Levels
RNase protection assays (RPAs) were employed to quantify tissue mRNA levels. Samples of total RNA were isolated from mouse tissues using Trizol Reagent (Invitrogen). 32P-labeled riboprobes were synthesized using a commercial mouse multiprobe kit (BD Biosciences, Pharmingen, San Diego, CA) containing templates against the following gene transcripts: iNOS, TNF-{alpha}, IL-1{alpha}, IL-1beta, IL-6, and IL-18. The riboprobes were hybridized with each RNA sample overnight at 56°C according to the manufacturer's instructions, using 20 µg of RNA for muscle tissues and 10 µg of RNA for the lungs and primary muscle cell cultures. The protected RNA fragments were separated using a 5% polyacrylamide gel and detected by autoradiography. Bands representing the individual mRNA species were then quantified using an image analysis system (FluorChem 8000; Alpha Innotech Corp, San Leandro, CA), and the signals were normalized to the L32 housekeeping gene to control for loading in each lane. Commercial ELISA kits (R&D Systems) were employed to determine muscle tissue levels of selected cytokines as previously described (32).

Bronchoalveolar Lavage
The trachea was cannulated with a 22-ga catheter connected to two separate syringes via a three-way stopcock. One syringe was used to instill 5 ml of cation-free Hanks' balanced salt solution (GIBCO, Burlington, ON, Canada) into the lungs, while the second syringe allowed the fluid to be collected by gentle aspiration. The total lavage fluid recovered was ~ 4 ml. Total cell numbers were determined using a hemocytometer. Differential cell counts were performed on cytospin preparations stained with Diff-Quick (American Scientific Products, McGaw Park, IL). From 300–400 cells were counted on each cytospin preparation, and the cells were classified as polymorphonuclear leukocytes, macrophages, and lymphocytes using standard morphologic criteria.

Analysis of Muscle Contractile Function
The diaphragm muscle was surgically excised for in vitro contractility measurements as previously described in detail (27). After removal, the diaphragm was immediately placed into a chilled (4°C) and equilibrated (95% O2–5%CO2, pH 7.38) Krebs solution with the following composition (in mM): 118 NaCl, 4.7 KCl, 2.5 CaCl2, 1.2 MgSO4, 1 KH2PO4, 25 NaHCO3, and 11 glucose. A muscle strip ~ 2 mm wide was dissected free, taking care to leave the central tendon and adjacent rib cage margins intact. The excised diaphragm strip was mounted into a jacketed tissue bath chamber filled with equilibrated Krebs solution, using a custom-built muscle holder containing two stimulation electrodes located on either side. A thermoequilibration period of 15 min was observed before initiating contractile measurements at 23°C. After placing the diaphragm strip at optimal length, the force–frequency relationship was determined by sequential supramaximal stimulation for 1 s at 5, 10, 20, 30, 50, 100, 120, and 150 Hz, with 2 min between each stimulation train. The force data were acquired to computer at a sampling rate of 1,000 Hz for later analysis. After completion of the above contractility studies, the muscles were removed from their baths, and muscle length was measured with a microcaliper accurate to 0.1 mm. Muscle force was normalized to tissue cross-sectional area, which was determined by assuming a muscle density of 1.056 g/cm3. Specific force (force/cross-sectional area) is expressed in Newtons/cm2.

Statistical Analysis
All data are presented as group mean values ± SE. Group mean differences were determined by ANOVA, with post hoc application of the Tukey test where appropriate. A statistics software package was used for all analyses (SigmaStat V2.0; SPSS, Chicago, IL). Statistical difference was defined as a P value < 0.05.


   RESULTS
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 References
 
Proinflammatory Gene Up-Regulation in the Diaphragm (but Not Limb Muscles) during P. aeruginosa Lung Infection
Proinflammatory gene mRNA levels were evaluated by RPAs in three groups of mice: (1) uninfected controls (CTL), (2) high-dose infection (1 x 106 cfu), and (3) low-dose infection (2 x 105 cfu). Figure 1A shows a representative RPA performed on total RNA extracted from the diaphragm in all three experimental groups at 48 h after infection, while Figure 1B depicts quantitative group mean data. After high-dose infection, there was substantial up-regulation of TNF-{alpha}, IL-1{alpha}, IL-beta, IL-6, and IL-18 within the diaphragm. In contrast, low-dose infection did not significantly modify the expression levels of these same cytokines as compared with baseline CTL values. Note that in the uninfected CTL group, there was a degree of constitutive basal expression of all the cytokines examined, the magnitude of which varied depending upon the cytokine in question. Interestingly, iNOS showed the highest level of constitutive expression in the diaphragm, but was not significantly modified by either high- or low-dose infection with P. aeruginosa at 48 h.


Figure 1
View larger version (32K):
[in this window]
[in a new window]

  		Figure 1. Bacterial dose-dependence of proinflammatory gene expression in the diaphragm. (A) RPA performed on diaphragms obtained from uninfected mice (CTL), as well as mice infected with inoculating doses of 1 x 106 cfu (High-dose) and 2 x 105 cfu (Low-dose) of P. aeruginosa. (B) Quantification of proinflammatory gene expression levels in the diaphragms of Pseudomonas-infected mice. All data are group means ± SE, n = 5 mice per experimental group. The data are expressed in arbitrary units, with the mean values obtained in the High-dose group defined as representing 100%. *P < 0.05 for comparison of infected groups (High-dose and Low-dose) to the CTL group (uninfected); {dagger}P < 0.05 for comparison of the High-dose to the Low-dose infection group.

 
We have previously reported different contractility responses of the diaphragm and limb muscles (soleus and extensor digitorum longus) to lung infection with P. aeruginosa, with only the diaphragm showing significant muscle weakness at 48 h after high-dose infection (4). Therefore, we also examined proinflammatory gene expression in the soleus muscle under the same conditions. In contrast to the diaphragm, high-dose P. aeruginosa infection did not significantly affect the level of proinflammatory cytokine expression in the soleus (see Figure 2). The same results were obtained for two other limb muscles, the extensor digitorum longus and the tibialis anterior (data not shown).


Figure 2
View larger version (75K):
[in this window]
[in a new window]

  		Figure 2. Lack of proinflammatory gene expression in the limb muscle during Pseudomonas lung infection. Representative RPA performed on the soleus hindlimb muscle, under CTL (uninfected) and High-dose (1 x 106 cfu) pulmonary infection conditions. In contrast to the diaphragm, there was no induction of proinflammatory gene expression within the soleus muscle during High-dose Pseudomonas lung infection.

 
In Vitro and In Vivo Expression of IL-10 and its Receptor
Figure 3A shows the effects of Ad-IL-10–mediated gene transfer upon IL-10 mRNA levels in cultured diaphragmatic muscle cells. As can be seen, myoblasts transduced with Ad-IL-10 exhibited strong IL-10 expression, whereas no detectable signal was obtained in cells infected with empty vector (i.e., lacking the IL-10 transgene). To determine whether adenovirus-mediated IL-10 gene transfer to muscle could modify serum IL-10 levels in vivo, mice in the high-dose infection group received Ad-IL-10 (1 x 108 pfu by intramuscular injection) at the time of pulmonary inoculation. Mice identically treated with an empty adenoviral vector served as a control group. There was no detectable IL-10 protein by ELISA in the serum of uninfected CTL mice (data not shown). Figure 3B shows the levels of IL-10 present in the serum at different time points after high-dose P. aeruginosa infection. In mice treated with Ad-IL-10, serum IL-10 levels were maximal at Day 1 and then began to taper off by Day 2. Serum levels of IL-10 were detectable but significantly lower in the infected mice treated with empty vector, and did not differ between Days 1 and 2. There were no differences in mortality between the infected mice treated with Ad-IL-10 or empty vector, and all animals were alive at 48 h after infection.


Figure 3
View larger version (29K):
[in this window]
[in a new window]

  		Figure 3. Effects of IL-10 gene transfer on IL-10 mRNA and protein expression. (A) Murine IL-10 mRNA was strongly expressed in Ad-IL-10–transduced myoblasts, but not in myoblasts treated with empty vector or PBS. (B) Adenovirus-mediated IL-10 gene transfer to hindlimb skeletal muscle led to substantial increases in IL-10 serum levels at Day 1 after treatment, whereas mice treated in an identical fashion with empty vector had significantly lower serum IL-10 levels. All mice were infected with Pseudomonas according to the High-dose protocol. The data are expressed as mean values ± SE; n = 6 mice per group. *P < 0.05 for comparison of Ad-IL-10 and empty vector groups.

 
To assess whether skeletal muscle is able to respond to IL-10 directly, we first determined by RT-PCR that the IL-10 receptor is expressed by diaphragmatic muscle in vivo as well as in cultured diaphragm muscle cells in vitro (Figure 4A). Cultured diaphragm muscle cells were then stimulated with cytokines (cytomix: TNF-{alpha} 2.5 ng/ml + IL-1{alpha} 25 U/ml), in the absence or presence of recombinant IL-10 treatment (50 ng/ml initiated 1 h before adding cytokines). As shown in Figure 4B, IL-10 treatment markedly suppressed the cytomix-induced up-regulation of IL-6 mRNA expression, indicating that diaphragm muscle cells are capable of responding directly to the biological actions of IL-10.


Figure 4
View larger version (49K):
[in this window]
[in a new window]

  		Figure 4. Expression and stimulation of the IL-10 receptor in diaphragm muscle cells. (A) IL-10 receptor expression in the diaphragm was confirmed by RT-PCR from in vitro (cultured diaphragmatic myoblasts and myotubes) as well as in vivo (whole diaphragm tissues) samples. Positive control (+CTL) consisted of T cells stimulated with IFN-{gamma}. (B) Effects of recombinant IL-10 on cultured diaphragm muscle cells. Exposure to cytokines (TNF-{alpha} + IL-1{alpha}) for 4 h led to marked up-regulation of IL-6 mRNA expression, and this response was greatly suppressed by pretreatment of the cells with recombinant IL-10.

 
Reduced Proinflammatory Cytokine Expression and Improved Function of the Diaphragm after IL-10 Gene Transfer
In mice with P. aeruginosa lung infection, analysis of BAL fluid revealed the expected large increase of inflammatory cell numbers (Figure 5A). Along these same lines, high-dose P. aeruginosa infection also led to marked up-regulation of proinflammatory gene expression in the lungs with the exception of IL-6, which was not detected (Figure 5B). However, there was no significant effect of IL-10 gene transfer on either BAL cell number or the expression levels of inflammatory cytokines in the lung, when compared with identically infected mice treated with either empty vector or PBS injection. Therefore, Ad-IL-10 treatment appeared to have little or no effect on the level of pulmonary inflammation in infected mice under these specific experimental conditions.


Figure 5
View larger version (22K):
[in this window]
[in a new window]

  		Figure 5. Effects of IL-10 gene transfer on pulmonary inflammation during Pseudomonas lung infection. (A) Inflammatory cell counts in BAL fluid at 48 h after being infected with the High-dose Pseudomonas protocol and simultaneously treated with PBS, empty vector or Ad-IL-10. There was no significant effect of IL-10 treatment. (B) Quantification of proinflammatory gene expression levels in the lungs of mice infected with the High-dose infection protocol and simultaneously treated with PBS, empty vector or Ad-IL-10. Proinflammatory gene expression within the lung was not modified by Ad-IL-10 treatment. *P < 0.05 for comparison of infected groups (PBS, empty vector, and Ad-IL-10) to the CTL group (uninfected). The data are expressed as mean values ± SE (n = 3 mice for CTL, 3 mice for PBS, 6 mice for empty vector, and 6 mice for Ad-IL-10).

 
In contrast to the lungs, IL-10 gene transfer had a major effect in suppressing proinflammatory cytokine expression in the diaphragm during high-dose P. aeruginosa infection, as shown in Figure 6. Empty vector had no significant effect on P. aeruginosa–induced cytokine up-regulation in the diaphragm, as compared with PBS-treated animals with lung infection. On the other hand, mice treated with Ad-IL-10 exhibited a significant blunting of the mRNA up-regulation normally found after high-dose P. aeruginosa infection for the following proinflammatory genes: TNF-{alpha} (79% reduction), IL-1{alpha} (72% reduction), IL-1beta (57% reduction), IL-6 (43% reduction), and IL-18 (46% reduction). Therefore, with the exception of iNOS, all of the proinflammatory genes examined in the diaphragm during high-dose P. aeruginosa infection were down-regulated by Ad-IL-10 treatment. These findings were confirmed at the protein level for IL-1{alpha} and IL-6, as shown in Figure 7.


Figure 6
View larger version (37K):
[in this window]
[in a new window]

  		Figure 6. Effects of IL-10 gene transfer on proinflammatory gene expression by the diaphragm during Pseudomonas lung infection. (A) RPA performed on the diaphragms of mice infected under the same experimental conditions as shown in Figure 5. In contrast to the lungs, Ad-IL-10 treatment greatly inhibited the up-regulation of proinflammatory gene expression in the diaphragms of mice receiving High-dose infection. (B) Quantification of proinflammatory gene expression levels in the diaphragms of Pseudomonas-infected mice treated with Ad-IL-10. All data are expressed in arbitrary units, with the mean values obtained in the PBS-treated group defined as representing 100%. *P < 0.05 for comparison of infected groups (PBS, empty vector, and Ad-IL-10) to the CTL group (uninfected); {dagger}P < 0.05 for comparison of the Ad-IL-10 group to the two other infected groups (PBS and empty vector; n = 3 mice for CTL, 3 mice for PBS, 6 mice for empty vector, and 6 mice for Ad-IL-10).

 

Figure 7
View larger version (6K):
[in this window]
[in a new window]

  		Figure 7. Effects of IL-10 gene transfer on cytokine protein levels in the diaphragm during Pseudomonas lung infection. ELISA quantification of diaphragmatic protein levels for (A) IL-1{alpha}, and (B) IL-6. The CTL group was uninfected (n = 5), whereas other groups were inoculated using the High-dose infection protocol. Values for Infected mice receiving PBS (n = 5) or empty vector (n = 7) did not differ from one another for either IL-1{alpha} or IL-6, and were thus pooled for statistical comparisons to the Ad-IL-10 group (n = 10). *P < 0.05 for comparison of Infected and Ad-IL-10 groups.

 
Finally, we wished to ascertain whether the above findings were associated with any alterations of diaphragmatic contractile function. Figure 8 illustrates the effects of Ad-IL-10 treatment on diaphragmatic force-generating capacity in the high-dose infection group. As we have previously reported (4), diaphragmatic force production was greatly depressed at 48 h after high-dose pulmonary infection with P. aeruginosa in the control (empty vector) group. However, in mice that were identically infected and treated with Ad-IL-10, the force-generating capacity of the muscle was greatly ameliorated. This is indicated by major changes throughout the force–frequency relationship of the diaphragm shown in Figure 8, such that for any given electrical stimulation frequency, contractile force was significantly higher in the Ad-IL-10 group.


Figure 8
View larger version (11K):
[in this window]
[in a new window]

  		Figure 8. IL-10 gene transfer greatly improves diaphragmatic force-generating capacity during Pseudomonas lung infection. All mice were inoculated with Pseudomonas using the High-dose infection protocol, and simultaneously treated with either Ad-IL-10 or empty vector by intramuscular injection (n = 8 mice per group). Diaphragm strips from Ad-IL-10–treated mice demonstrated significantly greater force-generating capacity over the entire range of stimulation frequencies applied to the muscle.

 

   DISCUSSION
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
References
 
Skeletal muscle dysfunction, including that involving the diaphragm, is frequent in patients with chronic pulmonary disease. Because reductions in skeletal muscle mass and function are associated with increased morbidity as well as mortality in patients with chronic lung disease (28), there is a need to better understand this process and its possible link to pulmonary infection. In this study, our specific objectives were as follows: (1) to ascertain the effects of different levels of P. aeruginosa lung infection on proinflammatory mediator gene expression by the diaphragm; (2) to compare the magnitude and pattern of proinflammatory mediator expression between diaphragm and limb muscle under identical conditions of P. aeruginosa lung infection; and (3) to determine whether systemic delivery of IL-10, achieved through adenovirus-mediated IL-10 gene transfer, could suppress proinflammatory mediator expression and improve force production in the diaphragms of Pseudomonas-infected mice. The mediators targeted by our study (iNOS, TNF-{alpha}, IL-1, IL-6, IL-18) were specifically selected on the basis of previous studies indicating their potential to cause muscle wasting or weakness (6–15, 29).

The principal findings of our study can be summarized as follows: (1) proinflammatory cytokine mRNA levels were highly induced within the diaphragm during P. aeruginosa lung infection, and this occurred in a bacterial dose–dependent manner; (2) induction of cytokine expression did not occur in the limb muscle under the same conditions, indicating a preferential sensitivity of the diaphragm to cytokine up-regulation by pulmonary infection; and (3) IL-10 gene transfer led not only to greatly attenuated cytokine upregulation within the diaphragm during P. aeruginosa lung infection, but also restored specific force generation of the diaphragm to normal levels. We also show for the first time that the IL-10 receptor is expressed by the diaphragm both in vitro and in vivo, and that diaphragm muscle cells have the ability to respond directly to IL-10.

Proinflammatory Gene Expression in the Diaphragm during Pulmonary Infection
To our knowledge, this is the first study to specifically examine the effects of pulmonary infection on proinflammatory cytokine expression within the diaphragm. Most investigations of sepsis effects on skeletal muscle have been performed in models of high-dose LPS exposure (5, 6, 30). However, the plasma cytokine profile in such models differs substantially from P. aeruginosa lung infection (31). Furthermore, a potential advantage of the lung infection model is the presence of several characteristics which are closer to the usual clinical situation in patients, such as its more sustained nature, additional virulence factors within the bacteria beyond LPS alone, and a more complex interaction between infecting organism and the host immune response.

In our previous study employing this model (4), diaphragmatic force was reduced with high-dose (1 x 106 cfu) but not low-dose (2 x 105 cfu) infection, whereas limb muscle force was unaffected at both doses. These findings formed the basis for our hypothesis (confirmed in this study) that under the same experimental conditions, diaphragm cytokine expression would demonstrate bacterial dose dependence, while limb muscle cytokine expression would remain unaltered even in the setting of high-dose infection. The fact that lung infection-associated increases in diaphragm cytokine mRNA levels were not mirrored by similar changes in the limb muscle remains unexplained, but is consistent with recent observations of differential cytokine responses between diaphragm and limb muscles after systemic administration of LPS (32). Several (6, 30, 33) but not all (34) studies by other groups have also reported a greater physiologic susceptibility of the diaphragm to LPS effects in comparison with limb muscles. On the other hand, van Heeckeren and coworkers (35) found a significant reduction in limb muscle mass (gastrocnemius and sartorius) in mice after 3 d of P. aeruginosa lung infection, although diaphragm responses were not evaluated.

Reasons for heterogeneous responses could include the different outcome measures examined in some studies, as well as different levels of exposure of the diaphragm and limb muscles to environmental factors such as inflammatory cells or cytokines. It should be noted that inflammatory cells are not increased in the diaphragm during P. aeruginosa lung infection at the 48-h time point (4). However, in our model cytokines could theoretically reach the diaphragm from either the bloodstream or the pleural space. In addition, oligonucleotide microarrays have revealed major differences in constitutive gene expression between diaphragm and limb muscles, with the diaphragmatic pattern suggesting a higher presence of antigen-presenting cells and other immune-responsive elements (36). This could account for a more vigorous cytokine response to infection. The diaphragm could also be more vulnerable due to its greater inherent workload, and this difference would be further exaggerated during pulmonary infection due to an increase in the work of breathing. Indeed, it has recently been reported that even in the absence of sepsis, increasing the workload of the respiratory muscles causes significant up-regulation of cytokines within the diaphragm (37). Because an increased workload will increase blood flow to the muscle, this could also result in greater exposure of diaphragm muscle fibers to bloodborne proinflammatory effectors originating from other organs. The latter mechanism would be consistent with the findings of Li and colleagues (38), who reported that overexpression of TNF-{alpha} in the heart caused spillover of this cytokine into the systemic circulation, with attendant oxidative stress and contractile dysfunction of the diaphragm.

Implications for Diaphragm Muscle Function
TNF-{alpha} has multiple effects on muscle, including the ability to directly inhibit force production (15), reduce protein synthesis (39), enhance protein degradation (40), and destabilize myogenic transcription factors such as MyoD (41). IL-1beta also inhibits muscle protein synthesis (12). The role of IL-18 in skeletal muscle function is not clear, but its up-regulation in cardiac muscle is associated with myocardial dysfunction (29, 42). IL-6 up-regulates the cathepsin as well as ubiquitin pathways of muscle proteolysis, and has been shown to induce atrophy of the diaphragm (10, 43). Interestingly, while iNOS has been implicated in the pathogenesis of diaphragmatic contractile dysfunction in LPS models (6), iNOS mRNA levels in the diaphragm were not significantly modified by P. aeruginosa lung infection in the present study. This may have been due to the more chronic nature of our model and the later time point examined. Some of the adverse effects of cytokines on skeletal muscle cells may also be mediated through their common ability to activate the transcription factor NF-{kappa}B (44), which induces muscle wasting and a loss of intrinsic force-generating capacity when constitutively overactivated in muscle (45). Overall, there is abundant evidence that increased levels of proinflammatory cytokines within skeletal muscle favor muscle wasting and weakness, particularly when multiple cytokine members are up-regulated at the same time (44, 46). Our findings further support this idea, since IL-10 treatment was able to largely abrogate cytokine gene up-regulation in the diaphragm and simultaneously prevent diaphragmatic weakness.

To our knowledge, this is the first study to document the presence of IL-10 receptor expression both in primary muscle cell cultures obtained from the diaphragm and at the whole tissue level. Moreover, the fact that recombinant IL-10 was able to directly suppress proinflammatory cytokine expression in cultured diaphragmatic cells exposed to putative sepsis mediators (TNF-{alpha}, IL-1{alpha}), indicates that the IL-10 receptor is functional in these cells. This is consistent with a prior report that IL-10 prevents IL-1{alpha}–induced intracellular adhesion molecule (ICAM)-1 expression by human myoblasts in vitro (47). Taken together, these findings all suggest that the beneficial effects of IL-10 gene delivery on diaphragmatic cytokine expression and contractile function observed in our study are likely to have resulted, at least in part, from the direct local actions of IL-10 on diaphragm muscle fibers. In addition, it is entirely possible that IL-10 gene transfer exerted additional beneficial effects upon diaphragmatic function by suppressing systemic proinflammatory cytokine release from other organs (48, 49). Therefore, while the relative importance of local versus systemic effects of IL-10 therapy on diaphragmatic function cannot be determined from our study, it is reasonable to speculate that both are likely to have played a significant role in the observed salutary effects.

Clinical Implications
Many patients with cystic fibrosis are chronically colonized with P. aeruginosa and suffer from repeated acute infectious exacerbations. The model used in our study has been used to mimic this scenario (25, 35), although it should be recognized that it only approximates the endobronchial pathology found in patients. In animal models as well as humans, there is evidence that the balance between pro- and anti-inflammatory cytokines determines the severity of the systemic response to infection. However, attempts to suppress the systemic inflammatory response in sepsis with anti-inflammatory therapies (e.g., anti-TNF antibodies or soluble receptors, IL-1 receptor antagonist) have thus far produced disappointing results in clinical trials (50). One reason may be the presence of redundant biological effects of the various proinflammatory cytokines, such that interference with any single cytokine pathway is insufficient to significantly impact upon the process. Accordingly, in the present study we used a more broad-based approach by employing IL-10, which inhibits multiple pathways involved in inflammation. Because of its very short half-life of only ~ 6 min (51), multiple bolus administrations (52) or continuous infusion of recombinant IL-10 protein via an indwelling pump (51) have been used by some investigators to achieve sustained IL-10 levels in the blood. Here we employed IL-10 gene transfer into skeletal muscle as a less invasive method for maintaining elevated systemic levels of IL-10 (22).

In previous studies examining the effects of IL-10 in sepsis, it was reported that exogenously supplied IL-10 can be either beneficial or detrimental, depending on the infection model employed. For example, IL-10 treatment improved survival in acute endotoxemia (23), and was also found to improve diaphragmatic force-generating capacity in animals treated with endotoxin (53). On the other hand, conflicting results were obtained in the cecal ligation and perforation model of polymicrobial sepsis (54). IL-10 can paradoxically promote inflammation under certain conditions, and this appears to be critically dependent upon the timing and dosage of IL-10 administration (22, 55). Under the conditions of IL-10 delivery employed in our study, there were no significant effects on total BAL inflammatory cell numbers or cytokine mRNA levels in the lung. At a later time point after infection, Chmiel and colleagues (52) found a reduction in inflammatory cells, but no significant changes in BAL cytokine levels or P. aeruginosa bacterial burden in the lungs of mice treated with recombinant IL-10, despite improvements in body weight and survival. These observations are collectively encouraging, as they suggest that IL-10 therapy can be titrated to a level that does not significantly interfere with the normal pulmonary defenses against P. aeruginosa infection, while still allowing for the achievement of other beneficial effects such as improved diaphragmatic function. Therefore, a strategy of altering the balance between pro- and anti-inflammatory cytokine expression in the diaphragm appears feasible, and deserves further investigation as a method for the prevention or treatment of respiratory muscle weakness in patients with severe pulmonary infection.


   Footnotes
 
This investigation was supported by grants from the Canadian Institutes of Health Research, Fonds de la recherche en sante du Quebec, Prix Marianne Josso, and Fondation pour la recherche medicale.

Originally Published in Press as DOI: 10.1165/rcmb.2006-0038OC on November 22, 2006

Conflict of Interest Statement: None of the authors has a financial relationship with a commercial entity that has an interest in the subject of this manuscript.

Received in original form January 26, 2006

Accepted in final form October 20, 2006


   References
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 

  1. Hussain SNA, Simkus G, Roussos C. Respiratory muscle fatigue: a cause of ventilatory muscle failure in septic shock. J Appl Physiol 1985;58:2033–2040.[Abstract/Free Full Text]
  2. Bone RC, Sprung CL, Sibbald WJ. Definitions for sepsis and organ failure. Crit Care Med 1992;20:724–726.[Medline]
  3. Montgomery A, Stager M, Carrico C, Hudson L. Causes of mortality in patients with the adult respiratory distress syndrome. Am Rev Respir Dis 1985;132:485–489.[Medline]
  4. Divangahi M, Matecki S, Dudley RW, Tuck SA, Bao W, Radzioch D, Comtois AS, Petrof BJ. Preferential diaphragmatic weakness during sustained Pseudomonas aeruginosa lung infection. Am J Respir Crit Care Med 2004;169:679–686.[Abstract/Free Full Text]
  5. Shindoh C, DiMarco A, Nethery D. Effect of PEG-superoxide dismutase on the diaphragmatic response to endotoxin. Am Rev Respir Dis 1992;145:1350–1354.[Medline]
  6. Boczkowski J, Lanone S, Ungureanu-Longrois D, Danialou G, Fournier T, Aubier M. Induction of diaphragmatic nitric oxide synthase after endotoxin administration in rats. J Clin Invest 1996;98:1550–1559.[Medline]
  7. Shindoh C, Hida W, Ohkawara Y, Yamauchi K, Ohno I, Takishima T, Shirato K. TNF-{alpha} mRNA expression in diaphragm muscle after endotoxin administration. Am J Respir Crit Care Med 1995;152:1690–1696.[Abstract]
  8. Wilcox P, Milliken C, Bressler B. High-dose tumor necrosis factor {alpha} produces an impairment of hamster diaphragm contractility. Am J Respir Crit Care Med 1996;153:1611–1615.[Abstract]
  9. Wilcox P, Osborne S, Bressler B. Monocyte inflammatory mediators impair in vitro hamster diaphragm contractility. Am Rev Respir Dis 1992;146:462–466.[Medline]
  10. Janssen SP, Gayan-Ramirez G. Van den BA, Herijgers P, Maes K, Verbeken E, Decramer M. Interleukin-6 causes myocardial failure and skeletal muscle atrophy in rats. Circulation 2005;111:996–1005.
  11. Li Y-P, Schwartz RJ, Waddell ID, Holloway BR, Reid MB. Skeletal muscle myocytes undergo protein loss and reactive oxygen-mediated NF-kB activation in response to tumor necrosis factor {alpha}. FASEB J 1998;12:871–880.[Abstract/Free Full Text]
  12. Cooney RN, Maish GO III, Gilpin T, Shumate ML, Lang CH, Vary TC. Mechanism of IL-1 induced inhibition of protein synthesis in skeletal muscle. Shock 1999;11:235–241.[Medline]
  13. de Alvaro C, Teruel T, Hernandez R, Lorenzo M. Tumor necrosis factor alpha produces insulin resistance in skeletal muscle by activation of inhibitor kappaB kinase in a p38 MAPK-dependent manner. J Biol Chem 2004;279:17070–17078.[Abstract/Free Full Text]
  14. Tracey KJ, Lowry SF, Beutler B, Cerami A, Albert JD, Shires GT. Cachectin/tumor necrosis factor mediates changes of skeletal muscle plasma membrane potential. J Exp Med 1986;164:1368–1373.[Abstract/Free Full Text]
  15. Reid MB, Lannergren J, Westerblad H. Respiratory and limb muscle weakness induced by tumor necrosis factor alpha: involvement of muscle myofilaments. Am J Respir Crit Care Med 2002;166:479–484.[Abstract/Free Full Text]
  16. Gogos CA, Drosou E, Bassaris HP, Skoutelis A. Pro- versus anti-inflammatory cytokine profile in patients with severe sepsis: a marker for prognosis and future therapeutic options. J Infect Dis 2000;181:176–180.[CrossRef][Medline]
  17. Fiorentino DF, Bond MW, Mosmann TR. Two types of mouse T helper cell. IV. Th2 clones secrete a factor that inhibits cytokine production by Th1 clones. J Exp Med 1989;170:2081–2095.[Abstract/Free Full Text]
  18. Fiorentino DF, Zlotnik A, Mosmann TR, Howard M, O'Garra A. IL-10 inhibits cytokine production by activated macrophages. J Immunol 1991;147:3815–3822.[Abstract]
  19. Bogdan C, Vodovotz Y, Nathan C. Macrophage deactivation by interleukin 10. J Exp Med 1991;174:1549–1555.[Abstract/Free Full Text]
  20. de Waal Malefyt R, Haanen J, Spits H, Roncarolo MG, te Velde A, Figdor C, Johnson K, Kastelein R, Yssel H, de Vries JE. Interleukin 10 (IL-10) and viral IL-10 strongly reduce antigen-specific human T cell proliferation by diminishing the antigen-presenting capacity of monocytes via downregulation of class II major histocompatibility complex expression. J Exp Med 1991;174:915–924.[Abstract/Free Full Text]
  21. Willems F, Marchant A, Delville JP, Gerard C, Delvaux A, Velu T, de Boer M, Goldman M. Interleukin-10 inhibits B7 and intercellular adhesion molecule-1 expression on human monocytes. Eur J Immunol 1994;24:1007–1009.[Medline]
  22. Xing Z, Ohkawara Y, Jordana M, Graham FL, Gauldie J. Adenoviral vector-mediated interleukin-10 expression in vivo: intramuscular gene transfer inhibits cytokine responses in endotoxemia. Gene Ther 1997;4:140–149.[CrossRef][Medline]
  23. Howard M, Muchamuel T, Andrade S, Menon S. Interleukin 10 protects mice from lethal endotoxemia. J Exp Med 1993;177:1205–1208.[Abstract/Free Full Text]
  24. Starke JR, Edwards MS, Langston C, Baker CJ. A mouse model of chronic pulmonary infection with Pseudomonas aeruginosa and Pseudomonas cepacia. Pediatr Res 1987;22:698–702.[Medline]
  25. Gosselin D, Stevenson MM, Cowley EA, Griesenbach U, Eidelman DH, Boulé M, Tam M-F, Kent G, Skamene E, Tsui L-C, et al. Impaired ability of Cftr knockout mice to control lung infection with Pseudomonas aeruginosa. Am J Respir Crit Care Med 1998;157:1253–1262.[Abstract/Free Full Text]
  26. Demoule A, Divangahi M, Danialou G, Gvozdic D, Larkin G, Bao W, Petrof BJ. Expression and regulation of CC class chemokines in the dystrophic (mdx) diaphragm. Am J Respir Cell Mol Biol 2005;33:178–185.[Abstract/Free Full Text]
  27. Yang L, Lochmüller H, Luo J, Massie B, Nalbantoglu J, Karpati G, Petrof BJ. Adenovirus-mediated dystrophin minigene transfer improves muscle strength in adult dystrophic (mdx) mice. Gene Ther 1998;5:369–379.[CrossRef][Medline]
  28. Maltais F, LeBlanc P, Jobin J, Casaburi R. Peripheral muscle dysfunction in chronic obstructive pulmonary disease. Clin Chest Med 2000;21:665–677.[CrossRef][Medline]
  29. Raeburn CD, Dinarello CA, Zimmerman MA, Calkins CM, Pomerantz BJ, McIntyre RC Jr, Harken AH, Meng X. Neutralization of IL-18 attenuates lipopolysaccharide-induced myocardial dysfunction. Am J Physiol Heart Circ Physiol 2002;283:H650–H657.[Abstract/Free Full Text]
  30. Lin MC, Ebihara S, el-Dwairi Q, Hussain SNA, Yang L, Gottfried SB, Comtois A, Petrof BJ. Diaphragm sarcolemmal injury is induced by sepsis and alleviated by nitric oxide synthase inhibition. Am J Respir Crit Care Med 1998;158:1656–1663.[Abstract/Free Full Text]
  31. Coopersmith CM, Amiot DM, Stromberg PE, Dunne WM, Davis CG, Osborne DF, Husain KD, Turnbull IR, Karl IE, Hotchkiss RS, et al. Antibiotics improve survival and alter the inflammatory profile in a murine model of sepsis from Pseudomonas aeruginosa pneumonia. Shock 2003;19:408–414.[CrossRef][Medline]
  32. Demoule A, Divangahi M, Yahiaoui L, Danialou G, Gvozdic D, Labbe K, Bao W, Petrof BJ. Endotoxin triggers NF-kB-dependent upregulation of multiple pro-inflammatory genes in the diaphragm. Am J Respir Crit Care Med 2006;174:646–653.[Abstract/Free Full Text]
  33. Hussain SN, Giaid A, El Dawiri Q, Sakkal D, Hattori R, Guo Y. Expression of nitric oxide synthases and GTP cyclohydrolase I in the ventilatory and limb muscles during endotoxemia. Am J Respir Cell Mol Biol 1997;17:173–180.[Abstract/Free Full Text]
  34. Supinski G, Nethery D, Stofan D, DiMarco A. Comparison of the effects of endotoxin on limb, respiratory, and cardiac muscles. J Appl Physiol 1996;81:1370–1378.[Abstract/Free Full Text]
  35. van Heeckeren AM, Tscheikuna J, Walenga RW, Konstan MW, Davis PB, Erokwu B, Haxhiu MA, Ferkol TW. Effect of Pseudomonas infection on weight loss, lung mechanics, and cytokines in mice. Am J Respir Crit Care Med 2000;161:271–279.[Abstract/Free Full Text]
  36. Porter JD, Merriam AP, Leahy P, Gong B, Feuerman J, Cheng G, Khanna S. Temporal gene expression profiling of dystrophin-deficient (mdx) mouse diaphragm identifies conserved and muscle group-specific mechanisms in the pathogenesis of muscular dystrophy. Hum Mol Genet 2004;13:257–269.[Abstract/Free Full Text]
  37. Vassilakopoulos T, Divangahi M, Rallis G, Kishta O, Petrof B, Comtois A, Hussain SN. Differential cytokine gene expression in the diaphragm in response to strenuous resistive breathing. Am J Respir Crit Care Med 2004;170:154–161.[Abstract/Free Full Text]
  38. Li X, Moody MR, Engel D, Walker S, Clubb FJ Jr, Sivasubramanian N, Mann DL, Reid MB. Cardiac-specific overexpression of tumor necrosis factor-alpha causes oxidative stress and contractile dysfunction in mouse diaphragm. Circulation 2000;102:1690–1696.
  39. Frost RA, Lang CH, Gelato MC. Transient exposure of human myoblasts to tumor necrosis factor-alpha inhibits serum and insulin-like growth factor-I stimulated protein synthesis. Endocrinology 1997;138:4153–4159.[Abstract/Free Full Text]
  40. Li YP, Chen Y, John J, Moylan J, Jin B, Mann DL, Reid MB. TNF-alpha acts via p38 MAPK to stimulate expression of the ubiquitin ligase atrogin1/MAFbx in skeletal muscle. FASEB J 2005;19:362–370.[Abstract/Free Full Text]
  41. Langen RC, Van Der Velden JL, Schols AM, Kelders MC, Wouters EF, Janssen-Heininger YM. Tumor necrosis factor-alpha inhibits myogenic differentiation through MyoD protein destabilization. FASEB J 2004;18:227–237.[Abstract/Free Full Text]
  42. Woldbaek PR, Tonnessen T, Henriksen UL, Florholmen G, Lunde PK, Lyberg T, Christensen G. Increased cardiac IL-18 mRNA, pro-IL-18 and plasma IL-18 after myocardial infarction in the mouse; a potential role in cardiac dysfunction. Cardiovasc Res 2003;59:122–131.[CrossRef][Medline]
  43. Tsujinaka T, Kishibuchi M, Yano M, Morimoto T, Ebisui C, Fujita J, Ogawa A, Shiozaki H, Kominami E, Monden M. Involvement of interleukin-6 in activation of lysosomal cathepsin and atrophy of muscle fibers induced by intramuscular injection of turpentine oil in mice. J Biochem (Tokyo) 1997;122:595–600.[Abstract/Free Full Text]
  44. Acharyya S, Ladner KJ, Nelsen LL, Damrauer J, Reiser PJ, Swoap S, Guttridge DC. Cancer cachexia is regulated by selective targeting of skeletal muscle gene products. J Clin Invest 2004;114:370–378.[CrossRef][Medline]
  45. Cai D, Frantz JD, Tawa NE Jr, Melendez PA, Oh BC, Lidov HG, Hasselgren PO, Frontera WR, Lee J, Glass DJ, et al. IKKbeta/NF-kappaB activation causes severe muscle wasting in mice. Cell 2004;119:285–298.[CrossRef][Medline]
  46. Frost RA, Nystrom GJ, Lang CH. Lipopolysaccharide regulates proinflammatory cytokine expression in mouse myoblasts and skeletal muscle. Am J Physiol Regul Integr Comp Physiol 2002;283:R698–R709.[Abstract/Free Full Text]
  47. Marino M, Scuderi F, Mannella F, Bartoccioni E. TGF-beta 1 and IL-10 modulate IL-1 beta-induced membrane and soluble ICAM-1 in human myoblasts. J Neuroimmunol 2003;134:151–157.[CrossRef][Medline]
  48. Sawa T, Corry DB, Gropper MA, Ohara M, Kurahashi K, Wiener-Kronish JP. IL-10 improves lung injury and survival in Pseudomonas aeruginosa pneumonia. J Immunol 1997;159:2858–2866.[Abstract]
  49. Kurahashi K, Kajikawa O, Sawa T, Ohara M, Gropper MA, Frank DW, Martin TR, Wiener-Kronish JP. Pathogenesis of septic shock in Pseudomonas aeruginosa pneumonia. J Clin Invest 1999;104:743–750.[Medline]
  50. Marshall JC. Clinical trials of mediator-directed therapy in sepsis: what have we learned? Intensive Care Med 2000;26:S75–S83.
  51. Ledeboer A, Binnekade R, Breve JJ, Bol JG, Tilders FJ, Van Dam AM. Site-specific modulation of LPS-induced fever and interleukin-1 beta expression in rats by interleukin-10. Am J Physiol Regul Integr Comp Physiol 2002;282:R1762–R1772.[Abstract/Free Full Text]
  52. Chmiel JF, Konstan MW, Knesebeck JE, Hilliard JB, Bonfield TL, Dawson DV, Berger M. IL-10 attenuates excessive inflammation in chronic Pseudomonas infection in mice. Am J Respir Crit Care Med 1999;160:2040–2047.[Abstract/Free Full Text]
  53. Taneda A, Shindoh C, Ohuchi Y, Shirato K. Protective effects of interleukin-10 on diaphragm muscle in a septic animal model. Tohoku J Exp Med 1998;185:45–54.[CrossRef][Medline]
  54. Oberholzer A, Oberholzer C, Moldawer LL. Interleukin-10: a complex role in the pathogenesis of sepsis syndromes and its potential as an anti-inflammatory drug. Crit Care Med 2002;30:S58–S63.[CrossRef][Medline]
  55. Lauw FN, Pajkrt D, Hack CE, Kurimoto M, van Deventer SJ, van der Poll T. Proinflammatory effects of IL-10 during human endotoxemia. J Immunol 2000;165:2783–2789.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
M. Jeyanathan, J. Mu, K. Kugathasan, X. Zhang, D. Damjanovic, C. Small, M. Divangahi, B. J. Petrof, C. M. Hogaboam, and Z. Xing
Airway Delivery of Soluble Mycobacterial Antigens Restores Protective Mucosal Immunity by Single Intramuscular Plasmid DNA Tuberculosis Vaccination: Role of Proinflammatory Signals in the Lung
J. Immunol., October 15, 2008; 181(8): 5618 - 5626.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
K. Strle, R. H. McCusker, R. W. Johnson, S. M. Zunich, R. Dantzer, and K. W. Kelley
Prototypical anti-inflammatory cytokine IL-10 prevents loss of IGF-I-induced myogenin protein expression caused by IL-1{beta}
Am J Physiol Endocrinol Metab, April 1, 2008; 294(4): E709 - E718.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Divangahi, T. Yang, K. Kugathasan, S. McCormick, S. Takenaka, G. Gaschler, A. Ashkar, M. Stampfli, J. Gauldie, J. Bramson, et al.
Critical Negative Regulation of Type 1 T Cell Immunity and Immunopathology by Signaling Adaptor DAP12 during Intracellular Infection
J. Immunol., September 15, 2007; 179(6): 4015 - 4026.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2006-0038OCv1
36/4/504    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Divangahi, M.
Right arrow Articles by Petrof, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Divangahi, M.
Right arrow Articles by Petrof, B. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2007 American Thoracic Society.