help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Published ahead of print on March 22, 2007, doi:10.1165/rcmb.2005-0253OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-0253OCv1
37/1/121    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, X.
Right arrow Articles by Rennard, S. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, X.
Right arrow Articles by Rennard, S. I.
American Journal of Respiratory Cell and Molecular Biology. Vol. 37, pp. 121-128, 2007
© 2007 American Thoracic Society
DOI: 10.1165/rcmb.2005-0253OC

The CC Chemokine Ligand 2 (CCL2) Mediates Fibroblast Survival through IL-6

Xiangde Liu, Anuk M. Das, Jonathan Seideman, Don Griswold, Chantal N. Afuh, Tetsu Kobayashi, Shinji Abe, Qiuhong Fang, Mitsu Hashimoto, Huijung Kim, Xingqi Wang, Lei Shen, Shin Kawasaki and Stephen I. Rennard

Pulmonary, Critical Care and Sleep Medicine, Internal Medicine, The Nebraska Medical Center, Omaha, Nebraska; and Immunobiology, Centocor Inc., Radnor, Pennsylvania

Correspondence and requests for reprints should be addressed to Stephen I. Rennard, University of Nebraska Medical Center, Department of Pulmonary and Critical Care Medicine, 985885 Nebraska Medical Center, Omaha, NE 68198-5885. E-mail: srennard{at}unmc.edu


   Abstract
Top
 Abstract
CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Apoptosis of lung structural cells is crucial in the process of normal tissue repair. Insufficient apoptosis of lung fibroblasts may contribute to the development of fibrosis. Since the CC chemokine ligand 2 (CCL2) is associated with fibrotic disease and the cytokine IL-6 blocks apoptosis in many cell types, we hypothesized that CCL2 may contribute to the development of lung fibrosis by inducing IL-6, which, in turn, inhibits fibroblast apoptosis. Fibroblasts were cultured in the presence of CCL2, which stimulated IL-6 production and mRNA expression in a concentration-dependent manner (250–1,000 ng/ml). This effect was mediated through the ERK1/2 signaling pathway. In addition, through a feedback loop, the secreted IL-6 activated the fibroblasts as evidenced by immunoblotting for phosphorylated STAT3. CCL2 reduced fibroblast apoptosis induced by staurosporin as detected by DNA content profiling (53.6 ± 10.8%, P < 0.05) and apoptosis induced by serum starvation as detected by COMET assay (Tail moment: 36.6 ± 9.9 of control versus 3.6 ± 1.4 of CCL2, P < 0.01). In the presence of anti–IL-6 neutralizing antibody, however, this anti-apoptotic effect of CCL2 was eliminated. These data suggest that CCL2 mediates fibroblast survival by inhibiting apoptosis through IL-6/STAT3 signaling and provides a novel mechanism through which CCL2 may contribute to the development and maintenance of lung fibrosis.

Key Words: CCL2 • IL-6 • STAT3 • survival



   CLINICAL RELEVANCE
Top
 Abstract
 CLINICAL RELEVANCE
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Lung fibroblasts express CCR2 and respond to CCL2 (MCP-1). CCL2 prolongs fibroblast survival through IL-6/STAT3 signaling, and thus may contribute to fibroblast persistence in fibrosis. Targeting CCL2/IL-6/STAT3 to reduce fibroblast populations may be a strategy to treat fibrosis.

 
Fibrosis is characterized by uncontrolled fibroblast activation leading to fibroblast proliferation, excessive collagen deposition and an increased number of myofibroblasts that disrupts normal tissue architecture (1, 2). While the mechanisms leading to fibrosis are not well understood, removal of the hyperactive fibroblasts and myofibroblasts during the resolution phase may play a role in the homeostatic control of fibrosis (3). Apoptosis (i.e. programmed cell death) is prominent in the late phase of wound healing, and may be a crucial mechanism through which excessive fibrosis may be prevented or resolved. In this context, many cytokines, including those likely present during inflammation, can modulate cellular apoptosis (4).

Among the cytokines that play a role in inflammatory lung disease is the CC chemokine ligand 2 (CCL2), also known as monocyte chemotactic protein-1 (MCP-1). It is a major chemoattractant factor responsible for the migration of monocytes and lymphocytes to sites of inflammation. CCL2 can also exert a number of other effects. Among these, CCL2 stimulates the release of IL-6 from synovial fibroblasts (5). In addition, several lines of evidence suggest that CCL2 may contribute to the development of fibrosis including both animal model and human studies (6, 7).

IL-6 is a multifunctional cytokine produced by a variety of cells, including fibroblasts. It is also active on many cells, including fibroblasts, and it can, therefore, function as an autocrine or paracrine mediator (8–10). IL-6 signals through a specific receptor, IL-6R, which dimerizes with gp130, a common receptor subunit for the IL-6 family of cytokines. By activating gp130, IL-6 leads to STAT3 activation and downstream events. Accumulating evidence indicates that IL-6 may be a pro-fibrogenic (11–13). Elevated levels of IL-6 are found in the lungs of patients with fibrotic lung disease (14). Since IL-6 can inhibit apoptosis in some cell types (15), it is possible that IL-6 could contribute to the development of fibrosis by inhibiting fibroblast apoptosis and that CCL2 could be profibrotic through inducing IL-6. The current study directly evaluated this potential mechanism of fibrosis in in vitro cultured fibroblasts.

We found that CCL2 stimulated IL-6 production by human lung fibroblasts through the extracellular signal–regulated kinase (ERK)1/2 signal pathway. Furthermore, CCL2 partially blocked staurosporin-induced apoptosis of lung fibroblasts through the IL-6/STAT3 pathway. These data provide support for a possible pro-fibrotic mechanism of action for CCL2 and IL-6.


   MATERIALS AND METHODS
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 References
 
Materials
Human fetal lung fibroblasts (HFL-1) were purchased from American Type Culture Collection (ATCC, Rockville, MD). Monocyte chemotactic protein 1 (MCP-1, CCL2) and anti–IL-6 neutralizing antibody were from R&D Systems (Minneapolis, MN). Anti-ERK1/2 antibody, anti–phospho-ERK1/2 antibody, anti-p38 antibody, anti–phospho-p38 antibody, anti-JNK1 antibody, and anti–phospho-JNK1 were purchased from Santa Cruz Biotech (Santa Cruz, CA). Anti-STAT3 and anti–phospho-STAT3 antibodies were purchased from Upstate (Charlottesville, VA). Primers and probe for IL-6 were designed using Primer Express software (Applied Biosystems, Foster City, CA) and synthesized at the Eppley Cancer Institute, University of Nebraska Medical Center. Chemokine C-C motif receptor 2B (CCR2B) primers were synthesized at the Eppley Cancer Institute, University of Nebraska Medical Center. Anti-CCR2 antibody was purchased from Sigma (St, Louis, MO). rRNA control kit was purchased from Applied Biosystems. Mitogen-activated protein kinase (MAPK) inhibitors, PD98059 and SB23048, were purchased from Calbiochem (San Diego, CA). All cell culture medium and supplements were purchased from Invitrogen Corp (Carlsbad, CA).

Cell Culture
The HFL-1 cells were cultured in Dulbecco's modified Eagle medium (DMEM), supplemented with 10% fetal calf serum (FCS), 100 µg/ml penicillin, 250 µg/ml streptomycin, 1.25 µg/ml fungizone, and 2 mM L-glutamine. Cells were fed three times per week in 100-mm tissue culture dishes (Becton Dickinson Labware, Lincoln Park, NJ), and confluent cells were passaged at a 1:4 ratio. For evaluation of the effect of CCL2, cells were plated at 105 cells/well (24-well) or 4 x 105 cells/well (6-well) in 10%FCS-DMEM (triplicate wells) overnight and then serum starved for 48 h. CCL2 was added and supernatants or cells were analyzed at different time points.

IL-6 Enzyme-Linked Immunosorbent Assay
The concentration of IL-6 in the culture medium was quantified by enzyme-linked immunosorbent assay (ELISA). Briefly, each 96-well plate was coated with anti–IL-6 antibody (Cat#: AB-206-NA; R&D Systems) overnight. After washing, IL-6 standard and samples were applied and incubated at room temperature for 2 h. The plate was washed again and incubated with rabbit anti-human IL-6 antibody (Cat# 407670; Calbiochem) at room temperature for 1 h. Horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (Cat# 611–1302; Rockland) was then applied for 1 h at room temperature. After a final washing, orthophenylenediamine together with H2O2 substrate was added and allowed to develop for 40–60 min at room temperature. After stopping the reaction with 8 M H2SO4, absorbance was read at 492 nm with a BenchMark microplate reader (Bio-Rad, Hercules, CA).

RT-PCR
CCR2 mRNA was detected by RT-PCR. Briefly, total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA) and 2 µg of total RNA was used to synthesize cDNA using high capacity RT reagent from Applied Biosystems. PCR for CCR2B was performed using Platinum PCR Supermix High Fidelity reagent (Cat # 12532–016; Invitrogen), and PCR for GAPDH was performed using AmpliTaq Gold Mixture reagent (Applied Biosystems). CCR2B primers were synthesized as follows (16): forward, 5'-ATGCTGTCCACATCTCGTTCTCG; reverse, 5'-TTATAAACCAGCCGAGACTTCCTGC. GAPDH primers was synthesized as follows (17): forward, 5'-TCGGAGTCAACGGATTTGGTCGTA; reverse: 5'-ATGGACTGTGGTCATGAGTCCTTC.

Real-Time RT-PCR
Cells were plated into 6-well plates at density of 2 x 105 cells/well in 2 ml 10% FCS-DMEM. On the following day, the medium was changed to serum-free DMEM. After 48 h of culture, cells were treated with reagents for 6 h. Total RNA was then extracted using Trizol reagent (Invitrogen) and 1 µg of total RNA was treated with DNAse I (Invitrogen) to eliminate potential genomic DNA contamination. For complementary DNA (cDNA) synthesis, about 600 ng of total RNA was transcripted into cDNA using reverse transcription reagents (Applied Biosystems).

Gene expression was measured with the use of an ABI Prism 7700 Sequence Detection System (Applied Biosystems) as described previously (18). Primers and TaqMan probes were designed using the Primer Express TM 1.0 (Applied Biosystems) software to amplify fewer than 150 base pairs. Probes were labeled at the 5' end with the reporter dye molecule FAM (6-carboxy-fluorescein) and at the 3'end with the quencher dye molecule Black Hole Quencher #1. Real-time PCR was conducted in a total volume of 50 µl with 1x TaqMan Master Mix (Applied Biosystems) and primers at 300 nM, and probes at 200 nM. Primer and probe sequences were as follows:

IL-6/47 forward: CTCCAGGAGCCCAGCTATGA

IL-6/112 reverse: CCCAGGGAGAAGGCAACTG

IL-6/68 probe: 5'- FAM-CTCCTTCTCCACAAGCGCCTTCGGT-BHQ1–3'.

For internal control, rRNA control kit (Applied Biosystem) was used.

Immunoblot
Cells were treated as described above and proteins were extracted using cell lysis buffer (20 mM Tris [pH 7.5], 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM b-glycerolphosphate, 1 mM Na3VO4, 1 µg/ml leupeptin, and 1mM PMSF). The total protein concentration was determined using Bio-Rad reagent. After heating for 3 min at 95°C, 10–20 µg of cell lysate extraction was loaded into each well to perform electrophoresis with mini-protein 3cell (Bio-Rad). The proteins were transferred to PVDF membranes (Bio-Rad) in transfer-buffer (20 mM Tris, pH 8.0, 150 mM glycine, 20% methanol) at 20 V for 40 min with a semi-dry electrophoretic transfer cell (Bio-Rad). The membrane was blocked with 5% nonfat milk in PBS-Tween at room temperature for 1 h and then exposed to primary antibodies at 4°C overnight. Target proteins were subsequently detected using IgG HRP (Rockland, Gilbertsville, PA) in conjunction with an enhanced chemiluminescence detection system (ECL; Amersham Pharmacia Biotech, Little Chalfont, Buckinghamshire, England).

Transfection of siRNA
Transfection of siRNA was performed as described previously (19). HFL-1 cells were plated into 12-well plate at a density of 105/well in 10%FCS-DMEM. The next day, cells were washed twice with PBS followed by transfection with 200 nM of siRNA targeting CCR2 or nontargeting siRNA (Dharmacon Inc., Lafayette, CO) using lipofectamine 2000 (Invitrogen). Cells were allowed to recover and treated with CCL2 (500 ng/ml) or LPS (10 µg/ml) for 48 h.

Profile of DNA Content by Flow Cytometry
To determine the presence of apoptotic cells, DNA content was measured by flow cytometry as reported previously (20). Cells were cultured in 6-well plates with 10% FCS-DMEM till confluent. Cells were then serum starved for 48 h followed by treatment with or without CCL2 (500 ng/ml) for an additional 48 h. Staurosporin (0.5 µM) was then added to induce apoptosis. After 4 h of staurosporin exposure, cells were detached from the tissue culture dishes with trypsin/EDTA. Cells were then pelleted and fixed with 70% ethanol at 4°C for 30 min. After staining with propidium iodide (50 µg/106 cells), cell DNA content analysis was performed by flow cytometry. Cells with less DNA staining than that of G1 cells (sub-G1 peaks or A0 cells) were considered apoptotic cells.

COMET Assay
COMET assay was performed using a commercially available kit (Trevigen Inc., Gaithersburg, MD). Briefly, HFL-1 cells were cultured in serum-free DMEM with or without 500 ng/ml CCL2 for 5 d. Cells were also treated with 0.5 µM staurosporine for 4 h as a positive control for apoptosis. Cells were harvested by trypsinization and used for COMET assay following the manufacturer's instruction. Image data was analyzed using public software as described previously (21).

Cell Count with Coulter Counter
Preliminary data indicated that culture of HFL-1 cells under serum-free conditions for 7 d led to induction of apoptosis. Based on this, HFL-1 cells were plated into 24-well plates and serum starved for 48 h. Cells were then cultured in serum-free medium with or without CCL2 for 7 d in order to induce apoptosis under serum-free culture. On Day 7, floating cells were removed and attached cells were trypsinized (0.5 ml Trypsine/EDTA for each well) and counted with Z Series Coulter Counter (Beckman Coulter, Miami, FL).

Statistical Analysis
All quantitative data are expressed as means ± SEM determined from representative experiments. Comparison of paired data was performed using the Student t test, while multigroup data was analyzed by ANOVA followed by Tukey correction using PRISM 4 software. P < 0.05 was considered significant.


   RESULTS
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 References
 
CCL2 Stimulates IL-6 Production in HFL-1 Cells
To determine if CCL2 stimulates human lung fibroblasts to produce cytokines and growth factors, nearly confluent HFL-1 cells were serum-starved for 48 h followed by treatment with different concentrations of CCL2 for an additional 48 h. IL-6, TGF-beta1, and vascular endothelial growth factor (VEGF) levels in the culture media were quantified by specific ELISA. CCL2 stimulated IL-6 release by HFL-1 cells in a concentration-dependent manner (250–1,000 ng/ml, Figure 1A). TGF-beta1 and VEGF production, however, were not affected by CCL2 (data not shown). The effect of CCL2 on IL-6 mRNA expression was also evaluated; CCL2 was found to stimulate IL-6 mRNA expression (Figure 1B). A concentration of 500 ng/ml CCL2 was found to elicit submaximal secretion of IL-6 and thus 500 ng/ml CCL2 was used for subsequent studies unless otherwise indicated.


Figure 1
Figure 1
View larger version (28K):
[in this window]
[in a new window]

  		Figure 1. CCL2 effect on IL-6 production and mRNA expression in HFL-1 cells. (A) HFL-1 cells were cultured overnight in 24-well plate (105/well) with 10% FCS-DMEM. After serum starvation for 48 h, cells were treated with varying concentrations of CCL2 for a further 48 h. IL-6 levels in cell culture supernatants were quantified by ELISA. Vertical axis: IL-6 concentration (pg/ml); horizontal axis: CCL2 concentration (ng/ml). (B) HFL-1 cells were cultured overnight in 6-well plate (4 x 105 cells/well) with 10% FCS-DMEM. After 48 h serum starvation, cells were treated with 500 ng/ml CCL2 for 6 h. Total RNA was extracted and real time RT-PCR was performed as described in MATERIALS AND METHODS. Vertical axis: IL-6 mRNA normalized to house keeping gene rRNA control; horizontal axis: CCL2 concentration (ng/ml).

 
CCR2 Is Expressed in Human Lung Fibroblasts and Mediates CCL2 Stimulation of IL-6
In order to confirm the effect of CCL2 on human lung fibroblasts, CCR2 expression by human lung fibroblasts was examined. Both adult and fetal lung fibroblasts expressed CCR2B mRNA, although the expression level was lower than that of THP-1 control cells (Figure 2A). CCR2 was also detected in human fetal lung fibroblasts by immunoblots. Interestingly, CCL2 did not stimulate CCR2 expression in HFL-1 cells (Figure 2B). Consistent with a role for CCR2 in mediating CCL2 stimulation of IL-6, stimulation of IL-6 release by CCL2 in HFL-1 cells was significantly decreased in the cells transfected with CCR2 siRNA but not with control siRNA (Figure 3). In contrast, LPS (10 µg/ml) significantly stimulated IL-6 release from HFL-1 cells transfected with either CCR2 siRNA or control siRNA (Figure 3), indicating the specificity of the siRNA in CCL2 stimulation.


Figure 2
Figure 2
View larger version (105K):
[in this window]
[in a new window]

  		Figure 2. CCR2 expression in human lung fibroblasts. (A) CCR2B mRNA expression. Total RNA was extracted from human bronchial fibroblasts (HBF) and HFL-1. RT-PCR was performed as described in MATERIALS AND METHODS. (B) CCR2 protein detection by immunoblot. HFL-1 cells were cultured in serum-free DMEM with 50 or 500 ng/ml CCL2 for 72 h. Cell lists were subjected for CCR2 immunoblot as described in MATERIALS AND METHODS.

 

Figure 3
View larger version (20K):
[in this window]
[in a new window]

  		Figure 3. CCR2 suppression by siRNA and its effect on CCL2 stimulated IL-6 release. HFL-1 cells were transfected with siRNA targeting CCR2 or nontargeting control siRNA as described in MATERIALS AND METHODS. The cells were then treated with CCL2 (500 ng/ml; lightly shaded bars) or LPS (10 µg/ml; darkly shaded bars) for 48 h. IL-6 amount was quantified by ELISA as described in MATERIALS AND METHODS. Open bars, SF-DMEM.

 
ERK1/2 Mediates CCL2 Stimulation of IL-6 Production
In order to determine if MAPK signaling is stimulated by CCL2 in HFL-1 cells, the phosphorylation status of ERK1/2, p38, and JNK were determined by immunoblot. CCL2 induced ERK1/2 phosphorylation biphasically (15 min and 24 h after treatment, respectively, Figure 2). In contrast, no phosphorylation of p38 or JNK1 was observed in response to CCL2 (Figure 4).


Figure 4
View larger version (68K):
[in this window]
[in a new window]

  		Figure 4. Effect of CCL2 on MAPK activation. HFL-1 cells were cultured overnight in 6-well plates with 10% FCS-DMEM. After 48 h serum starvation, cells were treated with CCL2 (500 ng/ml). Cells were harvested at varying time points as indicated using cell lysis buffer. Total protein amount was measured and immunoblots for phosphorylated (p) or total ERK1/2, p38, or JNK1 were performed as described in MATERIALS AND METHODS.

 
To further confirm MAPK pathway involvement in CCL2-induced IL-6 production by HFL-1 cells, the effects of the ERK1/2-specific inhibitor (PD98059) and the p38-specific inhibitor (SB23048) were evaluated. Consistent with the immunoblot evaluation of phosphorylation, the ERK1/2 inhibitor PD98059 (50 µM) significantly blocked CCL2 stimulation of IL-6 mRNA (Figure 5A) and protein synthesis (Figure 5B), while the p38 inhibitor SB23048 (10 µM) had no effect (Figure 5).


Figure 5
Figure 5
View larger version (33K):
[in this window]
[in a new window]

  		Figure 5. Effect of MAPK inhibitors on CCL2 stimulated IL-6 mRNA and protein synthesis. HFL-1 cells were treated with or without CCL2 (500 ng/ml) in the presence or absence of ERK inhibitor (PD98059, 50 µM; hatched bars) or p38 inhibitor (SB23048, 10 µM; shaded bars). Open bars, SF-DMEM. Cells were harvested after 6 h treatment for IL-6 mRNA quantification (A) or IL-6 protein measurement (B).

 
Effect of CCL2 on STAT3 Phosphorylation
Since the IL-6 family of cytokines signal through the STAT3 pathway and CCL2 stimulates IL-6 production in HFL-1 cells, the time course of STAT3 phosphorylation (Tyr705) was evaluated by immunoblot. Phosphorylated STAT3 was detected under serum free culture in HFL-1 cells, and this was significantly enhanced by 500 ng/ml CCL2 after 24 h of treatment (Figures 6A and 6B). Furthermore, the enhancement of STAT3 activation by CCL2 lasted for 72 h (Figure 6).


Figure 6
Figure 6
View larger version (39K):
[in this window]
[in a new window]

  		Figure 6. Effect of CCL2 on STAT3 activation. HFL-1 cells were cultured in 6-well plates (4 x 105/well) in 10% FCS-DMEM overnight. After 48 h of serum starvation, cells were treated with or without CCL2 (500 ng/ml) for up to 72 h. At indicated time points, cells were harvested with cell lysis buffer and the whole cell lysates were subjected to immunoblots for phosphorylated and total STAT3. (A) Immunoblots. Data presented are from one representative of two separate experiments. (B) Quantification of bar density. Data presented are mean ± SEM of two separate experiments. *P < 0.05 compared to control. Shaded bars, control; filled bars, CCL2.

 
Effect of CCL2 on Fibroblast Survival after Serum Withdrawal or in the Presence of Staurosporin
Since the IL-6/STAT3 pathway regulates production of anti-apoptotic proteins, leading to enhanced cell survival, the effect of CCL2 on fibroblast survival was determined using two protocols: serum withdrawal and staurosporin-induced apoptosis, which were analyzed by total cell counts and both COMET assay and DNA content profiling, respectively. After 5 d of serum withdrawal, the total cell number in the control group had slightly, but not significantly, decreased (8.7 ± 1.1 x 104 cells/well at 120 h versus 10 x 104 cells/well at 0 h, P > 0.05). In the presence of CCL2, however, the total cell number was significantly higher than control (13.9 ± 0.1 x 104 cells/well in the presence of 500 ng/ml CCL2 versus 8.7 ± 1.1 x 104 cells/well in the absence of CCL2, Figure 7A, *P < 0.01 by one-way ANOVA). Furthermore, when IL-6–neutralizing antibody (IL-6NAb, 2µg/ml) was added together with CCL2, the total cell number decreased significantly compared to CCL2 alone (7.3 ± 0.2 x 104 versus 8.8 ± 0.1 x 104 cells/well respectively, *P < 0.05, Figure 8A).


Figure 7
Figure 7
Figure 7
View larger version (83K):
[in this window]
[in a new window]

  		Figure 7. Effect of CCL2 on HFL-1 cell survival. (A) CCL2 effect on cell number determined by Coulter Counter. HFL-1 cells were plated in 24-well plate at a density of 105 cells/well (dotted line indicates original cell number plated into the tissue culture plate) and cultured in 10% FCS-DMEM overnight. After 48 h serum starvation, cells were cultured for additional 5 d in serum-free DMEM with varying concentrations of CCL2 as indicated. Cells were trypsinized and counted with Coulter Counter. Vertical axis: cell number on Day 5; horizontal axis: CCL2 concentrations. (B) CCL2 effect on apoptosis induced by staurosporin determined by DNA content assay. HFL-1 cells were plated in 6-well plate at a density of 2 x 105 cells/ml, 2ml/well in 10%FCS-DMEM and cultured overnight. After 48 h serum starvation, cells were treated with or without CCL2 (500ng/ml) for 2 d. Cells were then treated with staurosporine (STA, 0.5 µM) for 4 h followed by trypsinizing, fixing, and analyzing DNA content by flow cytometry as described in MATERIALS AND METHODS. Sub-G1 peak: indicating apoptotic cells. (C) CCL2 effect on apoptosis induced by serum starvation determined by COMET assay. HFL-1 cells were cultured in serum-free DMEM with or without CCL2 (500 ng/ml) for 5 d. COMET assay was performed and analyzed as described in MATERIALS AND METHODS.

 

Figure 8
Figure 8
View larger version (64K):
[in this window]
[in a new window]

  		Figure 8. Effect of anti–IL-6 neutralizing antibody (IL-6NAb) and CCL2 on cell survival. (A) Cell number determined by Coulter Counter. HFL-1 cells were plated in 24-well plates at a density of 105 cells/well and cultured in 10% FCS-DMEM overnight. After 48 h serum starvation, cells were cultured for an additional 5 d in serum-free DMEM with or without CCL2 (500 ng/ml) in the presence or absence of anti–IL-6–neutralizing antibody (IL-6NAb, 1 µg/ml) or nonrelevant anti-IgG antibody as control. Cells were trypsinized and counted by the Coulter Counter. Vertical axis: cell number on Day 5; horizontal axis: CCL2 concentrations. (B) DNA content analysis. HFL-1 cells were plated in 6-well plate at a density of 2 x 105 cells/ml, 2 ml/well in 10% FCS-DMEM and cultured overnight. After 48 h serum starvation, cells were treated with or without CCL2 (500 ng/ml) in the presence or absence of anti–IL-6 NAb (1 µg/ml) for 2 d. Cells were then treated with staurosporine (STA, 0.5 µM) for 4 h followed by trypsinizing, fixing, and analyzing DNA content by flow cytometry as described in MATERIALS AND METHODS. Sub-G1 peak: indicating apoptotic cells.

 
To study the effect of CCL2 on fibroblast apoptosis, staurosporin was used to induce apoptosis in HFL-1 cells. COMET assay and DNA content profiling were performed to detect apoptotic cells. In the presence of staurosporin (0.5 µM), hypodiploid cells, indicating apoptosis, were significantly increased (Figure 7B and Table 1). CCL2 (500 ng/ml) partially blocked apoptosis induced by staurosporin (40.6 ± 7.8% versus 21.5 ± 3.2%, P < 0.05). The inhibitory effect of CCL2 on staurosporin-induced apoptosis was prevented by the presence of anti–IL-6–neutralizing antibody, which by itself was without effect (Figure 8B). In addition, in the COMET assay, cells with a small DNA head and large fan-like tails (i.e. the typical morphology of apoptotic cells), were observed after 5 d of serum starvation (Figure 7C). In the presence of CCL2 (500 ng/ml), however, HFL-1 cells did not undergo apoptosis as evidenced by the morphology (Figure 7C) and COMET assay tail moment analysis (Figure 7C, 36.6 ± 9.9 for control versus 3.6 ± 1.4 for CCL2, P < 0.01 by t test).


View this table:
[in this window]
[in a new window]

  		TABLE 1. SUMMARY OF DNA CONTENT PROFILING

 

   DISCUSSION
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
References
 
Interactions between chemokines and cytokines play important roles in regulating tissue repair after inflammation or injury. In this regard, CCL2 and IL-6 are believed to be important in mediating fibrosis (22, 23). In the current study, CCL2 stimulated IL-6 release by human lung fibroblasts through ERK1/2 signaling but not through p38 or JNK. The IL-6 released by fibroblasts, in turn, functioned in an autocrine or paracrine manner and induced STAT3 activation. Through this pathway, CCL2 inhibited staurosporin- and serum deprivation–induced apoptosis, since neutralization of IL-6 by specific antibody blocked the inhibition of apoptosis. This pathway provides a mechanism by which CCL2 can contribute to the development of fibrosis by facilitating the persistent survival of fibroblasts.

CCL2, also known as monocyte chemotactic protein-1 (MCP-1), belongs to the CC chemokine family. Chemokines are small (8 to 14 kD) proteins that regulate migration of a variety of cells during inflammation. Based on the presence and position of the conserved cysteine residues, chemokines are categorized into CXC or {alpha}, CC or beta and C or {gamma} families. CCL2 mediates its biological activity through its G protein–coupled seven-transmembrane spanning receptor CCR2. CCR2 signals through G protein–coupled receptors (GPCRs), specifically Gi, to activate ERK1/2 signal pathway (24). In the current study, we found that CCL2 stimulated ERK1/2 phosphorylation in a biphasic manner. The mechanism of this remains to be defined.

Previous studies indicate that the CC family of chemokines are mostly responsible for modulating migration of monocytes and lymphocytes. In addition, the CC chemokines can also function as regulators of many other cell functions. In this regard, CCL2 has been shown to stimulate IL-6 and IL-8 production in fibroblast-like synoviocytes from patients with rheumatoid arthritis (5). In the current study, we have extended previous observations (5) and demonstrated a novel biological pathway for CCL2 and IL-6 in lung fibroblasts.

Both CCL2 and IL-6 are increased in fibrotic lesions in a variety of organs. IL-6 is a member of a family that includes IL-6, IL-11, leukemia inhibitory factor (LIF), oncostatin M (OSM), ciliary neurotrophic factor (CNTF), and cardiotrophin-1 (CT-1) (25–27). These cytokines are produced by a variety of cells in response to inflammatory stimuli and play pivotal roles in the immune, nervous, cardiovascular, and hematopoietic systems as well as in inflammation, wound healing, apoptosis, and embryonic development (25–28).

Emerging evidence from both animal and human diseases indicates that CCL2 is also associated with the development of fibrosis in various organs. Fibroblasts derived from fibrotic lesions from subjects with idiopathic pulmonary fibrosis (IPF), bronchiolitis obliterans syndrome, systemic sclerosis, and scleroderma highly express CCL2 (29–31). Consistent with a role for CCL2 in the development of fibrosis, CCR2 gene–deleted mice are protected from pulmonary fibrosis (7). Furthermore, neutralization strategies using either antibodies directed against one of the murine CCL2 orthologs JE (32) or overexpression of the CCR2 antagonist 7ND (6), also inhibits the development of pulmonary fibrosis in mice. Finally, recent data suggest an interaction between CCL2 and IL-6 as CCL2 stimulated IL-6 secretion in synovial fibroblasts (5). We therefore hypothesized that CCL2 may be implicated in fibrosis by regulating IL-6 release, thereby indirectly influencing fibroblast survival, and we have demonstrated that CCL2 stimulate IL-6 release from HFL-1 cells through ERK1/2 pathway.

Several studies from both human and animal models provide evidence that cytokines of the IL-6 family contribute to the development of fibrosis following inflammation (33, 34). In this context, elevated levels of IL-6 are found in the bronchoalveolar lavage fluids of patients with obliterative bronchiolitis (35). Further, edema fluid from the lungs of patients with acute lung injury (ALI) exhibit fibroblast mitogenic activity that is attributable to IL-6 (36), indicating a possible role for IL-6 in the fibroproliferative component of ALI. Similarly, in cells obtained from patients with IPF, IL-6 is able to stimulate cell proliferation (8) and inhibit apoptosis (37). Finally, mice with IL-6 deficiency showed enhanced airway inflammation but decreased subepithelial fibrosis after chronic exposure to aerosolized antigen (38).

The molecular mechanisms by which IL-6 contributes to the pathogenesis of lung fibrosis remain to be fully determined. One possible mechanism, however, is that IL-6 may block apoptosis of lung fibroblasts. By signaling through STAT3, cytokines of the IL-6 family can stimulate anti-apoptotic proteins in a variety of cells including tumor cells and fibroblasts from patients with IPF (11, 39). In the present study, cells treated with CCL2 were less susceptible to apoptosis induced by either serum withdrawal or staurosporin. This effect of CCL2 on cell survival was mediated through the IL-6/STAT3 pathway since an anti–IL-6–neutralizing antibody reversed the attenuated apoptosis induced by CCL2. Consistent with this mechanism, CCL2 was found to result in STAT3 activation in HFL-1 cells. These results suggest that CCL2 modulates fibroblast survival through an IL-6 feedback loop and the STAT3-signaling pathway.

In summary, a network of chemokines and cytokines may play critical roles in the development of pulmonary fibrosis. Among these cytokines, CCL2 and IL-6 have the potential to regulate the process of tissue remodeling leading to fibrosis. Targeting CCL2 and/or the IL-6/STAT3 pathway, therefore, may offer a novel therapeutic target for the treatment of fibrosis.


   Footnotes
 
Originally Published in Press as DOI: 10.1165/rcmb.2005-0253OC on March 22, 2007

Conflict of Interest Statement: A.M.D. is employed by Centocor (as a biomedical company, Centor has an interest in the subject matter of this manuscript). J.S. is a former employee of Centocor. D.G. is employed by Centocor. None of the other authors has a financial relationship with a commercial entity that has an interest in the subject of this manuscript.

Received in original form July 8, 2005

Accepted in final form January 4, 2007


   References
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 

  1. King TE, Schwarz MI, Brown K, Tooze JA, Colby TV, Waldron JA, Flint A, Thurlbeck W, Cherniack RM. Idiopathic Pulmonary Fibrosis. Relationship between histopathologic features and mortality. Am J Respir Crit Care Med 2001;164:1025–1032.[Abstract/Free Full Text]
  2. Mizuno S, Matsumoto K, Li MY, Nakamura T. HGF reduces advancing lung fibrosis in mice: a potential role for MMP-dependent myofibroblast apoptosis. FASEB J 2005;19:580–582.[Abstract/Free Full Text]
  3. Gharaee-Kermani M, Phan SH. Molecular mechanisms of and possible treatment strategies for idiopathic pulmonary fibrosis. Curr Pharm Des 2005;11:3943–3971.[CrossRef][Medline]
  4. Buhling F, Wille A, Rocken C, Wiesner O, Baier A, Meinecke I, Welte T, Pap T. Altered expression of membrane-bound and soluble CD95/Fas contributes to the resistance of fibrotic lung fibroblasts to FasL induced apoptosis. Respir Res 2005;6:37.[CrossRef][Medline]
  5. Nanki T, Nagasaka K, Hayashida K, Saita Y, Miyasaka N. Chemokines regulate IL-6 and IL-8 production by fibroblast-like synoviocytes from patients with rheumatoid arthritis. J Immunol 2001;167:5381–5385.[Abstract/Free Full Text]
  6. Inoshima I, Kuwano K, Hamada N, Hagimoto N, Yoshimi M, Maeyama T, Takeshita A, Kitamoto S, Egashira K, Hara N. Anti-monocyte chemoattractant protein-1 gene therapy attenuates pulmonary fibrosis in mice. Am J Physiol Lung Cell Mol Physiol 2004;286:L1038–L1044.[Abstract/Free Full Text]
  7. Moore BB, Paine R III, Christensen PJ, Moore TA, Sitterding S, Ngan R, Wilke CA, Kuziel WA, Toews GB. Protection from pulmonary fibrosis in the absence of CCR2 signaling. J Immunol 2001;167:4368–4377.[Abstract/Free Full Text]
  8. Moodley YP, Scaffidi AK, Misso NL, Keerthisingam C, McAnulty RJ, Laurent GJ, Mutsaers SE, Thompson PJ, Knight DA. Fibroblasts isolated from normal lungs and those with idiopathic pulmonary fibrosis differ in interleukin-6/gp130-mediated cell signaling and proliferation. Am J Pathol 2003;163:345–354.[Abstract/Free Full Text]
  9. Eckes B, Hunzelmann N, Ziegler-Heibtrock H-WL, Urbanski A, Luger T, Krieg T, Mauch C. Interleukin-6 expression by fibroblasts grown in three dimensional gel cultures. FEBS Lett 1992;298:229–232.[CrossRef][Medline]
  10. Fries KM, Felch ME, Phipps RP. Interleukin-6 is an autocrine growth factor for murine lung fibroblast subsets. Am J Respir Cell Mol Biol 1994;11:552–560.[Abstract]
  11. Moodley YP, Misso NL, Scaffidi AK, Fogel-Petrovic M, McAnulty RJ, Laurent GJ, Thompson PJ, Knight DA. Inverse effects of Il-6 on apoptosis of fibroblasts from pulmonary fibrosis and normal lungs. Am J Respir Cell Mol Biol 2003;29:490–498.[Abstract/Free Full Text]
  12. Tabata C, Kubo H, Tabata R, Wada M, Sakuma K, Ichikawa M, Fujita S, Mio T, Mishima M. All-trans retinoic acid modulates radiation-induced proliferation of lung fibroblasts via IL-6/IL-6R system. Am J Physiol Lung Cell Mol Physiol 2006;290:L597–L606.[Abstract/Free Full Text]
  13. Gomes I, Mathur SK, Espenshade BM, Mori Y, Varga J, Ackerman SJ. Eosinophil-fibroblast interactions induce fibroblast IL-6 secretion and extracellular matrix gene expression: implications in fibrogenesis. J Allergy Clin Immunol 2005;116:796–804.[CrossRef][Medline]
  14. Lesur OJ, Mancini NM, Humbert JC, Chabot F, Polu JM. Interleukin-6, interferon-gamma, and phospholipid levels in the alveolar lining fluid of human lungs: profiles in coal worker's pneumoconiosis and idiopathic pulmonary fibrosis. Chest 1994;106:407–413.[Medline]
  15. Hodge DR, Hurt EM, Farrar WL. The role of IL-6 and STAT3 in inflammation and cancer. Eur J Cancer 2005;41:2502–2512.[CrossRef][Medline]
  16. Tanaka S, Green SR, Quehenberger O. Differential expression of the isoforms for the monocyte chemoattractant protein-1 receptor, CCR2, in monocytes. Biochem Biophys Res Commun 2002;290:73–80.[CrossRef][Medline]
  17. Han KH, Tangirala RK, Green SR, Quehenberger O. Chemokine receptor CCR2 expression and monocyte chemoattractant protein-1-mediated chemotaxis in human monocytes: a regulatory role for plasma LDL. Arterioscler Thromb Vasc Biol 1998;18:1983–1991.[Abstract/Free Full Text]
  18. Bustin SA. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 2000;25:169–193.[Abstract]
  19. Kobayashi T, Liu X, Wen FQ, Fang Q, Abe S, Wang XQ, Hashimoto M, Shen L, Kawasaki S, Kim HJ, et al. Smad3 mediates TGF-beta1 induction of VEGF production in lung fibroblasts. Biochem Biophys Res Commun 2005;327:393–398.[CrossRef][Medline]
  20. Telford WG, King LE, Fraker PJ. Rapid quantitation of apoptosis in pure and heterogeneous cell populations using flow cytometry. J Immunol Methods 1994;172:1–16.[CrossRef][Medline]
  21. Liu X, Conner H, Kobayashi T, Kim H, Wen F, Abe S, Fang Q, Wang X, Hashimoto M, Bitterman P, et al. Cigarette smoke extract induces DNA damage but not apoptosis in human bronchial epithelial cells. Am J Respir Cell Mol Biol 2005;33:121–129.[Abstract/Free Full Text]
  22. Kershenobich Stalnikowitz D, Weissbrod AB. Liver fibrosis and inflammation: a review. Ann Hepatol 2003;2:159–163.[Medline]
  23. Atamas SP, White B. Cytokine regulation of pulmonary fibrosis in scleroderma. Cytokine Growth Factor Rev 2003;14:537–550.[CrossRef][Medline]
  24. Jimenez-Sainz MC, Fast B, Mayor F Jr, Aragay AM. Signaling pathways for monocyte chemoattractant protein 1-mediated extracellular signal-regulated kinase activation. Mol Pharmacol 2003;64:773–782.[Abstract/Free Full Text]
  25. Buettner R, Mora LB, Jove R. Activated STAT signaling in human tumors provides novel molecular targets for therapeutic intervention. Clin Cancer Res 2002;8:945–954.[Abstract/Free Full Text]
  26. Bowman T, Garcia R, Turkson J, Jove R. STATs in oncogenesis. Oncogene 2000;19:2474–2488.[CrossRef][Medline]
  27. Turkson J, Jove R. STAT proteins: novel molecular targets for cancer drug discovery. Oncogene 2000;19:6613–6626.[CrossRef][Medline]
  28. Galun E, Axelrod JH. The role of cytokines in liver failure and regeneration: potential new molecular therapies. Biochim Biophys Acta 2002;1592:345–358.[Medline]
  29. Belperio JA, Keane MP, Burdick MD, Lynch JP III, Xue YY, Berlin A, Ross DJ, Kunkel SL, Charo IF, Strieter RM. Critical role for the chemokine MCP-1/CCR2 in the pathogenesis of bronchiolitis obliterans syndrome. J Clin Invest 2001;108:547–556.[CrossRef][Medline]
  30. Rose CE Jr, Sung SS, Fu SM. Significant involvement of CCL2 (MCP-1) in inflammatory disorders of the lung. Microcirculation 2003;10:273–288.[CrossRef][Medline]
  31. Antoniades HN, Neville-Golden J, Galanopoulos T, Kradin RL, Valente AJ, Graves DT. Expression of monocyte chemoattractant protein 1 mRNA in human idiopathic pulmonary fibrosis. Proc Natl Acad Sci USA 1992;89:5371–5375.[Abstract/Free Full Text]
  32. Gharaee-Kermani M, McCullumsmith RE, Charo IF, Kunkel SL, Phan SH. CC-chemokine receptor 2 required for bleomycin-induced pulmonary fibrosis. Cytokine 2003;24:266–276.[CrossRef][Medline]
  33. Knight DA, Ernst M, Anderson GP, Moodley YP, Mutsaers SE. The role of gp130/IL-6 cytokines in the development of pulmonary fibrosis: critical determinants of disease susceptibility and progression? Pharmacol Ther 2003;99:327–338.[CrossRef][Medline]
  34. Scaffidi AK, Mutsaers SE, Moodley YP, McAnulty RJ, Laurent GJ, Thompson PJ, Knight DA. Oncostatin M stimulates proliferation, induces collagen production and inhibits apoptosis of human lung fibroblasts. Br J Pharmacol 2002;136:793–801.[CrossRef][Medline]
  35. Scholma J, Slebos DJ, Boezen HM, van den Berg JW, van der Bij W, de Boer WJ, Koeter GH, Timens W, Kauffman HF, Postma DS. Eosinophilic granulocytes and interleukin-6 level in bronchoalveolar lavage fluid are associated with the development of obliterative bronchiolitis after lung transplantation. Am J Respir Crit Care Med 2000;162:2221–2225.[Abstract/Free Full Text]
  36. Olman MA, White KE, Ware LB, Simmons WL, Benveniste EN, Zhu S, Pugin J, Matthay MA. Pulmonary edema fluid from patients with early lung injury stimulates fibroblast proliferation through IL-1 beta-induced IL-6 expression. J Immunol 2004;172:2668–2677.[Abstract/Free Full Text]
  37. Curnow SJ, Scheel-Toellner D, Jenkinson W, Raza K, Durrani OM, Faint JM, Rauz S, Wloka K, Pilling D, Rose-John S, et al. Inhibition of T cell apoptosis in the aqueous humor of patients with uveitis by IL-6/soluble IL-6 receptor trans-signaling. J Immunol 2004;173:5290–5297.[Abstract/Free Full Text]
  38. Qiu Z, Fujimura M, Kurashima K, Nakao S, Mukaida N. Enhanced airway inflammation and decreased subepithelial fibrosis in interleukin 6-deficient mice following chronic exposure to aerosolized antigen. Clin Exp Allergy 2004;34:1321–1328.[CrossRef][Medline]
  39. Song L, Turkson J, Karras JG, Jove R, Haura EB. Activation of Stat3 by receptor tyrosine kinases and cytokines regulates survival in human non-small cell carcinoma cells. Oncogene 2003;22:4150–4165.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. Mishra, M. Wang, J. Schlotman, N. M. Nikolaidis, C. W. DeBrosse, M. L. Karow, and M. E. Rothenberg
Resistin-like molecule-beta is an allergen-induced cytokine with inflammatory and remodeling activity in the murine lung
Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L305 - L313.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-0253OCv1
37/1/121    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, X.
Right arrow Articles by Rennard, S. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, X.
Right arrow Articles by Rennard, S. I.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2007 American Thoracic Society.