Published ahead of print on March 29, 2007, doi:10.1165/rcmb.2006-0449OC
American Journal of Respiratory Cell and Molecular Biology. Vol. 37, pp. 232-239, 2007
© 2007 American Thoracic Society DOI: 10.1165/rcmb.2006-0449OC
COX-2 Expression Induced by Diesel Particles Involves Chromatin Modification and Degradation of HDAC1
Dongsun Cao,
Philip A. Bromberg and
James M. Samet
Center for Environmental Medicine, Asthma and Lung Biology, University of North Carolina; and Human Studies Division, National Health and Environmental Effects Research Laboratory, Research Triangle Park, North Carolina
Correspondence and requests for reprints should be addressed to James M. Samet, Ph.D., Human Studies Division, National Health and Environmental Effects Research Laboratory, Research Triangle Park, NC 27711. E-mail: samet.james{at}epa.gov
 |
Abstract
|
|---|
Cyclooxygenase-2 (COX-2) plays an important role in the inflammatory response induced by physiologic and stress stimuli. Exposure to diesel exhaust particulate matter (DEP) has been shown to induce pulmonary inflammation and exacerbate asthma and chronic obstructive pulmonary disease. DEP is a potent inducer of inflammatory reponses in human airway epithelial cells. The mechanism through which DEP inhalation induces inflammatory mediator expression is not understood. In this report, we demonstrate that DEP can induce the expression of COX-2 gene in a human bronchial epithelial cell line (BEAS-2B) at both transcriptional and protein levels. The induction of COX-2 gene expression involves chromatin modification, in particular acetylation and deacetylation of histones. We show that exposure to DEP increases the acetylation of histone H4 associated with the COX-2 promoter and causes degradation of histone deacetylase 1 (HDAC1). Further, we establish that HDAC1 plays a pivotal role in mediating the transcriptional activation of the COX-2 gene in BEAS-2B cells exposed to DEP, supported by evidence that the down-regulation of HDAC1 using siRNA leads to activation of COX-2 gene expression, whereas overexpression of HDAC1 results in its repression. Finally, DEP exposure induced recruitment of histone acetyltransferase (HAT) p300 to the promoter of the COX-2 gene, suggesting that acetylation is also important in regulating its expression in response to DEP exposure. These results show for the first time acetylation via selective degradation of HDAC1, and that recruitment of HAT plays an important role in DEP-induced expression of the COX-2 gene.
Key Words: diesel exhaust particles COX-2 HDAC airway epithelial cells
Cyclooxygenase (COX) is a key enzyme that catalyzes the rate-limiting step in the synthesis of prostaglandins from arachidonic acid (1). There are two Cox genes in mammalian cells, COX-1 and COX-2. COX-1 is constitutively expressed in most cell types (1). COX-2 is minimally detectable under resting conditions, but can be induced to high levels of expression by various stimuli including proinflammatory factors, hormones, growth factors, and environmental stress such as oxidative stress (2, 3). Elevated expression of COX-2 has been associated with many chronic inflammatory diseases including rheumatoid arthritis, osteoarthritis, ulcerative colitis, and atherosclerosis (1).
Diesel exhaust particles (DEP) are ubiquitous ambient air pollutants, accounting for up to 90% of urban ultrafine particulate mass (4). Exposure to DEP has been associated with numerous adverse respiratory health outcomes including increased susceptibility to respiratory infections, increased risk of cancer, and exacerbation of asthma and chronic obstructive pulmonary disease (5). Inflammatory responses are thought to play a pivotal role in the pathophysiology of DEP inhalation (6, 7). In vitro and in vivo studies have shown that DEP can stimulate human airway epithelial cells to produce inflammatory cytokines and mediators such as IL-6, IL-8, granulocyte-macrophage colony-stimulating factor (GM-CSF), and intercellular adhesion molecule-1 (ICAM-1) (8). Increased expression of these genes is believed to be largely regulated at a transcriptional level. DEP was also found to potentiate LPS-stimulated COX-2 expression in human monocytes (9) and murine lung cells (10). It should be noted that V2O5, one of trace metals in DEP, can strongly induce expression of COX-2 expression in the distal airway epithelium (11). However, little is known about the effect of DEP on the expression of COX-2 in the human bronchial epithelium, a primary target of inhaled DEP. Moreover, no study has been reported on the molecular mechanism underlying DEP-induced expression of the COX-2 gene.
Reversible chromatin modifications, including acetylation, phosphorylation, and methylation, play a critical role in the transcriptional regulation of gene expression (12). Among those modifications, acetylation and deacetylation of histone lysine residue has been best characterized (13). DNA is tightly packaged into chromatin by histone proteins, which prevents access of transcriptional activators. Acetylation of histones results in unwinding of DNA wrapped around the histone core, allowing transcription activators access to DNA, thereby leading to gene expression (12). Many transcription co-activators have histone acetyltransferase activity (HAT), for example, p300/CBP (14), which can be recruited by activated transcription activators such as NF- B and activator protein-1 (AP-1) (15). NF- B is an important transcription factor mediating TNF- induced activation of expression of COX-2 gene (16). On the other hand, acetylation can be reversed by histone deacetylase (HDAC), which increases winding of DNA around a histone core, resulting in repression of gene expression (17).
In mammalian cells, there are at least 10 HDACs, which can be divided into two categories based on homology to their yeast counterparts (18). Class I HDACs are comprised of the proteins HDAC1, -2, -3, -8, and -11, which are homologous to yeast protein RPD3. They are universally expressed and localized in the nucleus (19). Class II is composed of HDAC4, -5, -7, -9, and -10, which are related to yeast HAD1. They are expressed in a tissue-specific manner and shuttle between cytoplasm and nucleus in response to signaling (20). Both classes of HDACs exist in a large repressor complex such as mSin3 and NruD (21), which can be brought to the promoters by interaction with transcription factors (22). HDACs can also directly interact with transcription factors, for example YY1 (23). Recently, HDAC1 and HDAC2 have been demonstrated to interact with NF- B, converting it from an activator to a repressor (24).
In this study, we show that chromatin acetylation plays a pivotal role in DEP-induced expression of COX-2 in the human bronchial epithelial cell line BEAS-2B. We found that COX-2 expression is up-regulated at both mRNA and protein levels in response to DEP treatment. Concurrently, acetylation of histone H4 in the COX-2 promoter is also increased and is accompanied by increased binding of p300 and RNA polymerase II but not p65 to the promoter. This is mediated through the selective degradation of HDAC1. These data suggest that histone acetylation is an important feature in DEP-induced expression of COX-2.
 |
MATERIALS AND METHODS
|
|---|
Reagents and Plasmid
Keratinocyte basal medium (KBM) and growth media (KGM) were obtained from Cambrex (East Rutherford, NJ). Rabbit polyclonal antibody against HDAC1, HDAC2, HDAC3, p65, and p300 were purchased from Santa Cruz (Santa Cruz, CA). Mouse monoclonal antibody against COX-2 was obtained from Cayman (Ann Arbor, MI). HDAC and HAT activity assay kits were purchased from Upstate (Lake Placid, NY). Antibody against -actin and Trichostatin A were purchased from Sigma (St. Louis, MO). The plasmids pKD-HDAC1-v4 encoding siRNA against HDAC1 and negative control vector pKD-NegCon-v1 were purchased from Upstate.
Preparation of DEP
DEP, designated NIST-DEP, was obtained from the National Institute of Sciences and Technology (NIST) Donaldson Company (Minneapolis, MN). The material was collected from the exhaust of a diesel-powered forklift and hot bag filter system. The diesel particulate material was collected in a 55-gallon drum, and subsequently homogenized in a V-blender for 1 h and stored in a polyethylene bags. The certified analyses of these particles are available at http://patapsco.nist.gov/srmcatalog/certificates/2975.pdf.
Cell Culture and Treatment
The human bronchial epithelial cell line BEAS-2B was cultured as previously described (25). In brief, 5 x 105 cells were seeded on tissue culture plate coated with human collagen (Sigma) and grown to confluence in KGM (Cambrex). This medium contains full supplements and growth factors. The cells were then passaged two or three times in KGM on ordinary tissue culture plates. Before treatment with NIST-DEP, cells were starved in KBM without supplements for 1216 h. No significant decrease in cell viability was found after treatment with up to 20 µg/cm2 NIST-DEP for 24 h (data not shown).
Western Blot Analysis
Western blot analysis was performed as previously described (25) with minor modification. Briefly, cells were lysed with lysis buffer containing 50 mM TrisHCL, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM phenylmethanesulfonyl fluoride, one tablet of proteinase inhibitor (Roche, Indianapolis, IN), 1% NP-40, 0.5% sodium deoxycholate, and 0.1% SDS. The lysates were sonicated for 10 s and centrifuged, and supernatants were collected. The protein concentration was determined using Protein Assay Solution (Bio-Rad, Hercules, CA). The lysates were separated by electrophoresis in SDS-PAGE and then transferred to a nitrocellulose membrane (Bio-Rad). Western blots were probed with antibodies described above. The protein bands were detected by enhanced chemiluminescence (Amersham, GE Healthcare, Piscataway, NJ).
HDAC Activity Assay
HDAC activity assays were performed using a colorimetric method according to the manufacturer's instructions (Upstate). Briefly, cells were treated with NIST-DEP at a concentration of 10 µg/cm2 for 4 h. The lysates were collected in RIPA and incubated with 100 µM of acetylated substrate in 40 µl of assay solution for 60 min at 37oC. Twenty microliters of Activator Solution was added to the reaction, followed by 10 min of incubation. The quantification of deacetylation activity was determined by reading absorbance at 405 nm.
HAT Activity Assay
HAT activity assay was performed according to manufacturer's instructions. Briefly, total cellular protein was extracted and suspended in 150 µl of HAT buffer (50 mM Tris-HCL, pH 8.0, 10% glycerol, 1 mM dithiothreitol, 0.1 mM ethylenediaminetetraacetic acid [EDTA], protease inhibitor). The reaction was set up by adding 2 µl of core histones, 5 µl of 5x HAT assay buffer, 5 µl of [3H]acetyl-coenzyme A, and 13 µl of cellular extracts followed by 10 min of incubation at 30oC. Ten microliters of reaction mixture was spotted onto p81 paper and, after drying, washed three times with 10% trichloroacetic acid for 5 min each followed by the final wash with 95% ethanol. The dried filter was counted in a liquid scintillation counter.
DNA Transfection and Luciferase Assays
Transfections of BEAS-2B cells and luciferase assays were performed as previously described (26). Cells were seeded at a density of 5 x 104 cells per well in 6-well plates and grown to 5070% confluence. Unless otherwise indicated, 100 ng of reporter plasmid, 100 ng of Renilla luciferase, and 100 ng of each activator plasmid were used. The total amount of DNA per well was kept constant by adding the corresponding amount of expression vector without a cDNA insert. Transfections were performed using FuGENE 6 (Roche) according to the manufacturer's instruction. After 3648 h of incubation, luciferase activity was determined using a Dual Luciferase assay kit (Promega, Madison, WI). All of the transfection experiments were repeated at least twice in duplicate. Values are expressed as means ± SD.
Transfections of BEAS-2B cells with plasmids encoding siRNA against HDAC1 were carried out using Effectene according to manufacturer's instruction (Qiagen, Valencia, CA).
ChIP Assays
Chromatin immunoprecipitation (ChIP) assays were carried out using the ChIP assay kit from Upstate Biotech. Briefly, cellular proteins were cross-linked with 1% formaldehyde at 37°C for 10 min. After being washed with cold PBS twice, cells were scraped in 500 µl of PBS and centrifuged at 5,000 rpm. The pellets were then resuspended in 300 µl of SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl [pH 8.1], protease inhibitors). The lysate was sonicated three times for 10 s each to shear the DNA into segments between 200 and 1,000 bp in length. After being centrifuged at 14,000 rpm for 10 min, the supernatants were diluted 10-fold with ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl [pH 8.1], 167 mM NaCl, protease inhibitors). One milliliter of the diluted lysate was then cleared with 10 µg of salmon sperm DNA and 20 µl of protein A-agarose beads at 4°C for 1 h. After brief centrifugation to pellet the beads, the supernatant was incubated with 2 µl of specific antibodies overnight at 4°C. The next day, 10 µg of salmon sperm DNA and 40 µl of protein A-agarose beads were added to the supernatant, and the mixture was incubated for 2 h. The beads were then washed sequentially with low-salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl [pH 8], 150 mM NaCl), high-salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl [pH 8], 500 mM NaCl), and LiCl wash buffer (0.25 mM LiCl, 1% NP-40, 1% deoxycholate, 1 mM EDTA, 10 mM Tris-HCl [pH 8.1]) for 5 min each. The beads were then washed two times with Tris-EDTA, and the precipitates were eluted twice with 200 µl of elution buffer (1% SDS, 0.1 M NaHCO3). Twenty microliters of 5 M NaCl was added to each eluate, and the mixture was incubated at 65°C for 4 h to reverse cross-linking. DNA fragments were then purified with a QIAquick spin column. The anti-IgG antibody was from Santa Cruz, and the anti-acetyl histone H3 and H4 antibody used was from Upstate. The primers for the COX-2 promoter were 5'GGCAAAGACTGCGAAGAAGA3' and 5'GGGTAGGCTTTGCTGTCTGA 3'. The PCR product covers DNA sequence from 307 to +46 and contains NF- B, cyclic AMP response element (CRE), CCAAT-enhancer binding protein (C/EBP), and TATA cis-elements in the promoter region. The PCR reaction was performed at 95°C for 2 min followed by 35 cycles of 95oC for 30 s, 55oC for 30 s, and 72oC for 30 s. The PCR products were separated on a 1.4% agarose gel and stained with ethidium bromide.
Real-Time PCR
Relative gene expression in BEAS-2B cells was quantified using real-time quantitative PCR. Total RNA was isolated using a Qiagen kit (Qiagen) and reverse transcribed to generate cDNA using a High Capacity cDNA Archive kit (Applied Biosystems, Foster City, CA). Oligonucleotide primer pairs and fluorescent probes for COX-2 and GAPDH were designed using a primer design program (Primer Express; Applied Biosystems) and obtained from Integrated DNA Technologies (Coralville, IA). The HDAC1 primer/probe set was obtained as a Taqman pre-developed assay reagent (concentrated and pre-optimized mix of primers and FAM-labeled Taqman probe) from Applied Biosystems. Quantitative fluorogenic amplification of cDNA was performed using the ABI Prism 7500 Sequence Detection System (Applied Biosystems), primers and probes of interest and TaqMan Universal PCR Master Mix (Applied Biosystems). The relative abundance of mRNA levels were determined from standard curves generated from a serially diluted standard pool of cDNA prepared from BEAS-2B cells. The relative abundance of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was used to normalize levels of the mRNAs of interest.
 |
RESULTS
|
|---|
DEP Exposure Induces Expression of COX-2 Gene at mRNA and Protein Levels
In a previous in vitro study in human monocytes it was reported that exposure to DEP induced increased expression of COX-2 at the mRNA level without an accompanying elevation in the protein concentration (9). Because the epithelium of the conducting airways is the first tissue challenged by inhaled DEP, we chose to examine COX-2 expression in response to DEP using the human bronchial epithelial cell line BEAS-2B as a model.
BEAS-2B cells were grown to confluence, and placed in media deprived of growth factors overnight before being treated with NIST-DEP at a concentration of 10 µg/cm2 for 4, 8, and 16 h. The levels of COX-2 mRNA were measured using real-time PCR. As shown in Figure 1A, exposure to DEP increased COX-2 gene expression at a transcriptional level. Compared with unexposed controls, the levels of COX-2 mRNA increased markedly, peaking at 8 h of exposure before diminishing at 16 h. Western Blot analysis showed that levels of COX-2 protein increased following a pattern consistent with that predicted by the mRNA levels over the same time course (Figure 1B). In contrast, mRNA and protein levels of the constitutively expressed COX-1 enzyme were not changed by DEP exposure of BEAS cells (data not shown). These data showed that exposure to DEP can increase the expression of COX-2 at both mRNA and protein levels in BEAS-2B cells.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 1. DEP induces expression of the COX-2 gene. BEAS-2B cells were grown to confluence and stimulated with NIST-DEP (10 µg/cm2) for 4, 8, and 12 h. (A) Total RNA was isolated, and the levels of COX-2 mRNA were quantified by real-time PCR and normalized relative to the levels of GAPDH. (B) Lysates were collected in RIPA buffer and 30 µg of protein was loaded for electrophoresis. The expression levels of COX-2 protein were detected using antibody against COX-2. The levels of -actin were used to demonstrate equal loading.
|
|
DEP Exposure Induces the Acetylation of Histone H4
Having established that DEP activate expression of COX-2 gene at a transcriptional level, we next examined the role of histone modification in this effect. Since hyperacetylation of histone tails is associated with increased gene expression and histone H3 and H4 are the principal histone targets of HDAC enzymatic activity (27), we used the ChIP assay to determine whether DEP treatment results in an increase in acetylated histones H3 or H4 in the promoter region of COX-2 in BEAS-2B cells. Cells were treated with NIST-DEP (10 µg/cm2) for 4 h and chromatin was then immunoprecipitated with an antibody raised against acetyl H3 and H4. The DNA in the COX-2 promoter (from 307 to +46) was amplified by PCR using specific primers and the amplicon was detected by electrophoresis. As shown in Figure 2, cells stimulated with NIST-DEP for 4 h exhibited a stronger COX-2 band than cells without NIST-DEP treatment, indicating that exposure to DEP increased the acetylation in histone H4 associated with the COX-2 promoter. In contrast, there was no significant change in acetyl histone H3 in response to NIST-DEP treatment. An increase in acetyl histone H4 without a concomitant change in acetyl histone H3 has been shown to occur in the insulinoma cell line MIN6 stimulated with glucose, and in A549 cells treated with TNF- (28, 29).

View larger version (10K):
[in this window]
[in a new window]
|
Figure 2. DEP induces acetylation of histone H4 in promoter region of COX-2. BEAS-2B cells were treated with NIST-DEP (10 µg/cm2) for 4 h. ChIP assay was then performed with antiacetyl-H3 and antiacetyl-H4 antibodies. Precipitates from the antibody against IgG served as a negative control. Two percent of the diluted DNA was used as loading control. The target sequence for PCR was located around the COX-2 gene promoter covering DNA sequence from 307 to +46.
|
|
DEP Exposure Inhibits HDAC Activity
The acetylation status of core histones is dynamically controlled by the opposing actions of two classes of enzymes, HAT and HDAC (12, 13). HATs acetylate lysines in the N-terminal tail of histones, whereas HDACs catalyze the removal of these acetyl groups. Under resting conditions, the activities of these enzymes are in equilibrium. A disruption of this balance can result in hyperacetylation or hypoacetylation, leading to activation or repression of gene expression (12, 13). To investigate whether the DEP-induced change in H4 acetylation status is due to alterations in HDAC activity, we assayed the enzymatic activity of HDAC using a colorimetric method based on the spectrophotometric detection of the chromophore p-nitroanilide. As shown in Figure 3A, HDAC activity in BEAS-2B cells was dose-dependently inhibited in response to treatment with NIST-DEP at a concentration as low as 5 µg/cm2. As a negative control, H2O did not induce HDAC activity, while TSA, a general HDAC inhibitor, potently inhibited HDAC activity, as expected. These results suggested that DEP exposure inhibits HDAC activity in the BEAS-2B cells.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 3. DEP inhibits HDAC activity. Cells were treated with NIST-DEP at indicated concentrations for 4 h. (A) The HDAC activity assay was performed using a colorimetric method based on spectrophotometric detection of the chromophore p-nitroanilide. The activity of HDAC was positively correlated with amount of p-nitroanilide released from substrate. H2O was used as a negative control. TSA-treated sample served as a positive control. (B) HAT activity assay was performed based on the incorporation [3H] into histones after incubation of the total cellular protein extracted from the NIST-DEPtreated cells with core histones and [3H] acetyl-coenzyme A. H2O was used as a negative control. Recombinant p300 served as a positive control.
|
|
We also investigated the possibility that the increase in acetylated H4 in DEP-exposed BEAS-2B cells is partly the result of an increase in HAT activity in the BEAS-2B cells. HAT activity in BEAS-2B cell lysates was assayed by measuring the incorporation of [3H]Acetyl-CoA into a core histone substrate. As shown in Figure 3B, BEAS-2B cells had detectable levels of HAT activity. However, exposure to NIST-DEP for 4 h did not cause a significant alteration in HAT activity (Figure 3). These data demonstrated that NIST-DEP treatment does not directly increase HAT activity, implying that the increase in H4 acetylation following NIST DEP exposure is primarily due to an inhibition of HDAC in BEAS-2B cells.
DEP Exposure Down-Regulates the Expression of HDAC1 through a Proteasomal Pathway
The observation of decreased HDAC activity suggested diminished levels of HDAC protein in DEP-treated BEAS-2B cells. HDAC1, -2, and -3 are present in lung tissue, and their expression is altered in response to inflammatory states (30). We therefore measured levels of HDAC1, -2, and -3 after DEP treatment. Constitutive expression of HDAC1, -2, and -3 protein was detectable in cell lysates prepared from untreated BEAS-2B cells (Figure 4A). NIST-DEP exposure induced a marked time-dependent reduction in the level of HDAC1 in these cells, which was evident by 1 h and progressed by 4 h of exposure. No effect of NIST-DEP exposure was evident on the expression of HDAC2 and -3 (Figure 4A).
PCR analysis showed that DEP exposure did not result in a change in mRNA levels of HDAC1 in BEAS-2B cells, suggesting that the DEP-induced loss of HDAC protein is post-transcriptionally regulated (Figure 4B). Proteasomal and lysosomal protein degradation are two major post-transcriptional mechanisms that regulate intracellular levels of specific proteins. To evaluate the role of these pathways in the DEP-induced loss of HDAC1, BEAS-2B cells were treated with MG132, an inhibitor of the proteasome pathway, or with chloroquine, an inhibitor of the lysosomal pathway, for 30 min before treatment with 10 µg/cm2 of NIST-DEP for 4 h. As shown in Figure 4C, MG132 significantly blocked NIST-DEP-induced HDAC1 disappearance, whereas chloroquine did not have a discernible effect. These results indicated that exposure to DEP induces degradation of HDAC1 via a mechanism that is dependent on proteasomal activity in BEAS-2B cells.
Loss of HDAC1 Mediates COX-2 Expression in Response to DEP Exposure
A series of experiments was undertaken to further characterize the link between DEP-induced degradation of HDAC1 and the expression of COX-2 in human bronchial epithelial cells. First, we tested the effect of the histone deacetylase activity inhibitor Trichostatin A (TSA) on COX-2 mRNA levels in BEAS-2B cells. As shown in Figure 5, treatment with TSA increased expression of the COX-2 gene in a dose- and time-dependent manner, demonstrating that down-regulation of HDAC activity can lead to the transcriptional activation of COX-2 gene expression in BEAS-2B cells.

View larger version (8K):
[in this window]
[in a new window]
|
Figure 5. HDAC inhibitor, Trichostatin A (TSA), enhances expression of COX-2 gene. BEAS-2B cells were treated with TSA at varying concentrations for 4 h (A) or with 10 µM TSA for varying hours (B). Total RNA was isolated and the level of COX-2 mRNA was quantified by real-time PCR and normalized to GAPDH mRNA.
|
|
Next, we used siRNA to knock down expression of HDAC1 and measured the effect on the expression of the COX-2 gene. Transfection of the plasmid encoding siRNA against HDAC1 reduced the expression of HDAC1 by 40% (Figure 6A). As a negative control, transfection of a plasmid encoding a scrambled RNA had no effect on HDAC1 RNA levels. In the cells in which HDAC1 expression was diminished, expression of the COX-2 gene increased 2-fold relative to the scrambled control. These data demonstrate that knock-down of HDAC1 can cause transcriptional activation of COX-2 gene expression.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 6. HDAC1 is involved in the transcriptional activation of COX-2 expression. (A) BEAS-2B cells were transfected with plasmid encoding siRNA against HDAC1 and incubated for 48 h. Total RNA was isolated and levels of HDAC1 and COX-2 mRNA were quantified using real-time PCR. Levels of GAPDH were used an internal control. The plasmid encoding scrambled si RNA served as a negative control. (B) BEAS-2B cells were grown to 70% confluence, and then cells were transfected with COX-2luciferase reporter plasmid together with plasmid encoding HDAC1 or empty plasmid and incubated for 36 h, followed by treatment with NIST-DEP (10 µg/cm2) for 8 h. Plasmid encoding Renilla luciferase was used as an internal control. Luciferase activity was assayed as described in MATERIALS AND METHODS.
|
|
To further examine the functional relevance of HDAC1 expression levels in the activation of the COX-2 gene, we examined the effect of overexpression of HDAC1 on COX-2 promoter activity in DEP-exposed BEAS-2B cells. As shown in the Figure 6B, DEP-NIST increased COX-2 promoter activity in a dose-dependent manner, suggesting that DEP can stimulate the COX-2 expression in a manner consistent with the PCR data presented in Figure 1. Overexpression of HDAC1 effectively blocked the expression of COX-2 in induced by a wide range of DEP concentrations (Figure 6B).
Together these data show that the level of HDAC1 expression is a functional determinant of COX-2 expression in BEAS-2B cells under baseline conditions as well as in response to DEP exposure.
DEP Exposure Increases p300 Binding to the COX-2 Promoter
While the results shown in Figure 3 ruled out an increase in HAT activity, they did not exclude the possibility that an alteration in the intracellular distribution of HAT activity contributes to DEP-induced COX-2 expression. HAT p300 has been shown to be recruited by NF- B to the COX-2 promoter in response to TNF- (16). We therefore investigated the involvement of p300 in DEP-induced COX-2 expression using the ChIP assay.
Relative to unexposed controls, exposure to DEP induced a clear increase in levels of p300 bound to the COX-2 promoter in BEAS-2B cells (Figure 7). DEP treatment also induced an elevation in the binding of Pol II. In contrast, there was no effect on the intensity of p65 binding to the COX-2 promoter relative to controls (Figure 7).

View larger version (14K):
[in this window]
[in a new window]
|
Figure 7. DEP increases binding of p300 to the promoter of COX-2. BEAS-2B cells were treated with NIST-DEP for 4 h. ChIP assay was then performed with antiPol II and anti-p300 antibodies. Precipitates from the antibody against IgG served as a negative control. Two percent of the diluted DNA was used as loading control. The lower panel shows schematically the region in the promoter of COX-2 gene, which was amplified by PCR.
|
|
 |
DISCUSSION
|
|---|
A number of studies have shown that the adverse effects of DEP exposure include inflammatory responses that are underlain by an elevated expression of inflammatory mediators (8, 31, 32). Indeed, it has been demonstrated in vitro and in vivo that DEP can induce expression of proinflammatory genes including cytokines, chemokines, and various mediators in airway alveolar and epithelial cells (31, 32). Although COX-2 has been associated with several inflammatory diseases (33), its expression and regulation in human epithelial cells with regard to DEP exposure have not been reported. In this study, we demonstrate for the first time that DEP exposure can induce expression of COX-2 gene at both mRNA and protein levels in bronchial epithelial cells and describe a novel mechanism for this response that involves chromatin modification secondary to a specific degradation of HDAC1.
Given the pivotal role of COX-2 in the synthesis of prostaglandins that are involved in inflammation, our finding that DEP exposure induces its expression is consistent with the adverse effects of DEP inhalation. However, in contrast to the observations presented herein, previous reports showed that DEP exposure had little effect on COX-2 gene expression in human myocytes (9) or murine macrophages and fibroblasts (10). Furthermore, while DEP exposure was found to enhance LPS-stimulated expression of COX-2 gene in human monocytes, it did not show any effect on the modulation of PDGF- and LPS-induced COX-2 expression in murine fibroblasts and macrophages (10). Cell-type differences may explain the variation in COX-2 induction observed in fibroblasts and macrophages in comparison to airway epithelial cells. The regulation of COX-2 gene expression is subject to oxidative stress, which activates mitogen-activated protein (MAP) kinase cascades, leading to activation of NF- B (34). It has been demonstrated that DEP can activate NF- B by inducing oxidative stress and activating MAP kinase pathways in both epithelial and macrophage cells (31). Additional work will be needed to investigate the regulation of COX-2 gene expression, as it differs in these two types of cells in response to DEP.
The elevation of COX-2 may also have a protective role in response to challenge of DEP. It was reported that COX-2-/- mice exhibit increased lung inflammation and airway hyperresponsiveness compared with wild type after ovalbumin sensitization and treatment. Gavett and coworkers also reported a similar result using V2O5 (35). In a study by Bonner and colleagues, the authors showed that ablation of the COX-2 gene in mice leads to increased inflammatory response and development of pulmonary fibrotic lesions after treatment of V2O5 (11). In this in vitro study we showed that DEP induced expression of COX-2 in human airway epithelial cells. Whether elevated expression of COX-2 in response to DEP plays a protective or detrimental role in airways awaits further study using COX-2 knockout animals. It should be noted that while well-regulated expression of COX-2 has a protective role, prolonged overexpression may be a key player in many human inflammatory disorders.
Post-translational modifications of HDAC have been found to play pivotal roles in the regulation of gene expression. These modifications include phosphorylation (36, 37), sumoylation (38, 39), and ubiquitination (40). HDACs that are modified with these groups have altered transcriptional repression activity (38, 39), lose the ability to interact with transcription factors (36), or are targeted for degradation (40). For example, sumoylation is required for HDAC1 to achieve full repressive activity (39). Similarly, phosphorylation of HDAC1 and -2 leads to the disruption of its ability to interact with other transcription factors such as YY1 (36). Some chemicals can selectively target HDAC for proteasome-mediated degradation. Specifically, treatment with quinidine induced degradation of HDAC1 in human breast tumor cell lines (41). Valproic acid was found to selectively induce degradation of HDAC2, although it did not affect levels of other HDACs, including HDAC1, -3, -4, -5, and -8 (42). Our present data show that DEP induced selective degradation of HDAC1 via the proteasome-mediated pathways in BEAS-2B cells while having no effect on the protein levels of HDAC2 and HDAC3.
Recently, it has been reported that oxidatively modified proteins can be selectively degraded via the proteasome, through a mechanism that is independent of ubiquitination (43). The adverse effects that DEP exerts on bronchial epithelial cells has been shown to involve the generation of oxidative stress, which reduces HDAC activity and HDAC2 expression (44). We therefore speculate that oxidative stress induced by DEP treatment leads to oxidation of HDAC1, which is subsequently recognized by proteasome regulatory components and targeted for degradation. Oxidative stress can also induce ubiquitination of proteins and promote their degradation in this manner (45). Therefore, further study is needed to distinguish between these two mechanisms as contributors of DEP-induced COX-2 expression.
Although the mechanism responsible for the specificity in mediating the targeted destruction of HDAC1 is not known, selective degradation of HDACs has been observed in inflammatory pulmonary diseases. In bronchial biopsies from patients with asthma, there is a reduction in the expression of HDAC1, while the expression of HDAC2 and HDAC3 are unaffected (30). In addition, in COPD pulmonary tissue there is a significant reduction in the expression of HDAC2 with lesser reductions in HDAC3 and HDAC5 (46). Therefore, in view of the fact that the inflammatory response is a central feature in both DEP-induced pathogenesis and lung diseases such as asthma and COPD, it will be of great interest to isolate the components of DEP that induce selective degradation of HDAC1 and to study the mechanisms involved.
The COX-2 promoter contains cis-elements for multiple transcription activators including NF- B, NFIL-6, AP-1, CRE-binding protein, and C/EBP(47). Different external stimuli use a combination of distinct cis-elements in the COX-2 gene promoter to activate its expression by activating a specific group of transcription factors (16, 48). The cis elements used to drive COX-2 gene expression in response to DEP are not yet determined. Nonetheless, DEP has been shown to be a potent activator of NF- B in bronchial epithelial cells (49). Thus we examined whether DEP increases binding of p65 to COX-2 promoter in this study. Our data demonstrate that p65 is bound to COX-2 in the untreated cells and that its binding is not further increased by stimulation of DEP, which is in contrast to our observation that DEP increased p65 binding to the IL-8 promoter (data not shown). This observation indicates that DEP-induced COX-2 and IL-8 gene expression involves a distinct mechanism at the molecular level. The transcription co-activator p300 and RNA Pol II binding were both increased in the COX-2 promoter in response to DEP treatment. The mechanism through which p300 is recruited to the COX-2 promoter in response to DEP treatment is not known. However, it was reported previously that p300 interacts with p65 (50). This suggests that DEP induces activation of p300 and promotes its binding to p65 already bound to the COX-2 promoter, leading to the enhanced expression of COX-2 gene. It should be pointed out that we can not exclude the possibility of involvement of other transcription factors in the recruitment of p300 to COX-2 promoter, for example, AP-1, which can be activated by DEP treatment and interact with p300 (42).
In summary, we provide evidence that DEP exposure can enhance the expression of COX-2 in bronchial epithelial cells at a transcriptional level. We found that the mechanism by which DEP induces COX-2 expression involves chromatin modification. In particular, DEP exposure increases the acetylation of H4, likely by selective degradation of HDAC1 and recruitment of p300. The functional relevance of HDAC1 in the regulation of the COX-2 gene is supported by the evidence that loss of HDAC promotes COX-2 expression, whereas overexpression of HDAC1 inhibits DEP-induced COX-2 transcription. These results expand our understanding of the mechanism of DEP induced inflammatory responses in bronchial epithelial cells. More importantly, the mechanism identified in this study provides a foundation from which we may identify the bioactive components present in DEP and develop strategies to mitigate the adverse effects of DEP inhalation.
 |
Acknowledgments
|
|---|
The authors are grateful to Mr. Robert Silbajoris and Lisa Daily for their excellent technical assistance.
 |
Footnotes
|
|---|
Portions of this work were performed under Contract EP-C-04-023 with ARCADIS G&M Inc.
The research described in this article has been reviewed by the National Health and Environmental Effects Research Laboratory and National Risk Management Research Laboratory, U.S. EPA, and approved for publication. The contents of this article should not be construed to represent Agency policy, nor does mention of trade names or commercial products constitute endorsement or recommendation for use.
Originally Published in Press as DOI: 10.1165/rcmb.2006-0449OC on March 29, 2007
Conflict of Interest Statement: None of the authors has a financial relationship with a commercial entity that has an interest in the subject of this manuscript.
Received in original form December 5, 2006
Accepted in final form January 12, 2007
 |
References
|
|---|
- Smith WL, Garavito RM, DeWitt DL. Prostaglandin endoperoxide h synthases (cyclooxygenases)-1 and -2. J Biol Chem 1996;271:3315733160.[Free Full Text]
- Inoue H, Nanayama T, Hara S, Yokoyama C, Tanabe T. The cyclic amp response element plays an essential role in the expression of the human prostaglandin-endoperoxide synthase 2 gene in differentiated u937 monocytic cells. FEBS Lett 1994;350:5154.[CrossRef][Medline]
- Seibert K, Zhang Y, Leahy K, Hauser S, Masferrer J, Perkins W, Lee L, Isakson P. Pharmacological and biochemical demonstration of the role of cyclooxygenase 2 in inflammation and pain. Proc Natl Acad Sci USA 1994;91:1201312017.[Abstract/Free Full Text]
- Programme UNE. Enviroment 1994;36:537.
- Sydbom A, Blomberg A, Parnia S, Stenfors N, Sandstrom T, Dahlen SE. Health effects of diesel exhaust emissions. Eur Respir J 2001;17:733746.[Abstract/Free Full Text]
- Pope CA III, Burnett RT, Thurston GD, Thun MJ, Calle EE, Krewski D, Godleski JJ. Cardiovascular mortality and long-term exposure to particulate air pollution: epidemiological evidence of general pathophysiological pathways of disease. Circulation 2004;109:7177.[Abstract/Free Full Text]
- Sagai M, Saito H, Ichinose T, Kodama M, Mori Y. Biological effects of diesel exhaust particles: I. In vitro production of superoxide and in vivo toxicity in mouse. Free Radic Biol Med 1993;14:3747.[CrossRef][Medline]
- Kawasaki S, Takizawa H, Takami K, Desaki M, Okazaki H, Kasama T, Kobayashi K, Yamamoto K, Nakahara K, Tanaka M, et al. Benzene-extracted components are important for the major activity of diesel exhaust particles: effect on interleukin-8 gene expression in human bronchial epithelial cells. Am J Respir Cell Mol Biol 2001;24:419426.[Abstract/Free Full Text]
- Hofer TP, Bitterle E, Beck-Speier I, Maier KL, Frankenberger M, Heyder J, Ziegler-Heitbrock L. Diesel exhaust particles increase lps-stimulated cox-2 expression and pge2 production in human monocytes. J Leukoc Biol 2004;75:856864.[Abstract/Free Full Text]
- Inoue K, Takano H, Yanagisawa R, Ichinose T, Sadakane K, Yoshino S, Yamaki K, Uchiyama K, Yoshikawa T. Components of diesel exhaust particles differentially affect lung expression of cyclooxygenase-2 related to bacterial endotoxin. J Appl Toxicol 2004;24:415418.[CrossRef][Medline]
- Bonner JC, Rice AB, Ingram JL, Moomaw CR, Nyska A, Bradbury A, Sessoms AR, Chulada PC, Morgan DL, Zeldin DC, et al. Susceptibility of cyclooxygenase-2-deficient mice to pulmonary fibrogenesis. Am J Pathol 2002;161:459470.[Abstract/Free Full Text]
- Grunstein M. Histone acetylation in chromatin structure and transcription. Nature 1997;389:349352.[CrossRef][Medline]
- Karagiannis TC, El-Osta A. Modulation of cellular radiation responses by histone deacetylase inhibitors. Oncogene 2006;25:38853893.[CrossRef][Medline]
- Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y. The transcriptional coactivators p300 and cbp are histone acetyltransferases. Cell 1996;87:953959.[CrossRef][Medline]
- Vanden Berghe W, De Bosscher K, Boone E, Plaisance S, Haegeman G. The nuclear factor-kappab engages cbp/p300 and histone acetyltransferase activity for transcriptional activation of the interleukin-6 gene promoter. J Biol Chem 1999;274:3209132098.[Abstract/Free Full Text]
- Deng WG, Zhu Y, Wu KK. Up-regulation of p300 binding and p50 acetylation in tumor necrosis factor-alpha-induced cyclooxygenase-2 promoter activation. J Biol Chem 2003;278:47704777.[Abstract/Free Full Text]
- Marks P, Rifkind RA, Richon VM, Breslow R, Miller T, Kelly WK. Histone deacetylases and cancer: causes and therapies. Nat Rev Cancer 2001;1:194202.[CrossRef][Medline]
- Bertos NR, Wang AH, Yang XJ. Class ii histone deacetylases: structure, function, and regulation. Biochem Cell Biol 2001;79:243252.[CrossRef][Medline]
- Dangond F, Gullans SR. Differential expression of human histone deacetylase mrnas in response to immune cell apoptosis induction by trichostatin a and butyrate. Biochem Biophys Res Commun 1998;247:833837.[CrossRef][Medline]
- Fischle W, Emiliani S, Hendzel MJ, Nagase T, Nomura N, Voelter W, Verdin E. A new family of human histone deacetylases related to saccharomyces cerevisiae hda1p. J Biol Chem 1999;274:1171311720.[Abstract/Free Full Text]
- Jones PL, Shi YB. N-cor-hdac corepressor complexes: Roles in transcriptional regulation by nuclear hormone receptors. Curr Top Microbiol Immunol 2003;274:237268.[Medline]
- Ayer DE, Lawrence QA, Eisenman RN. Mad-max transcriptional repression is mediated by ternary complex formation with mammalian homologs of yeast repressor sin3. Cell 1995;80:767776.[CrossRef][Medline]
- Yang WM, Inouye C, Zeng Y, Bearss D, Seto E. Transcriptional repression by yy1 is mediated by interaction with a mammalian homolog of the yeast global regulator rpd3. Proc Natl Acad Sci USA 1996;93:1284512850.[Abstract/Free Full Text]
- Ashburner BP, Westerheide SD, Baldwin AS Jr. The p65 (rela) subunit of nf-kappab interacts with the histone deacetylase (hdac) corepressors hdac1 and hdac2 to negatively regulate gene expression. Mol Cell Biol 2001;21:70657077.[Abstract/Free Full Text]
- Samet JM, Graves LM, Quay J, Dailey LA, Devlin RB, Ghio AJ, Wu W, Bromberg PA, Reed W. Activation of mapks in human bronchial epithelial cells exposed to metals. Am J Physiol 1998;275:L551L558.[Medline]
- Cao D, Wang Z, Zhang CL, Oh J, Xing W, Li S, Richardson JA, Wang DZ, Olson EN. Modulation of smooth muscle gene expression by association of histone acetyltransferases and deacetylases with myocardin. Mol Cell Biol 2005;25:364376.[Abstract/Free Full Text]
- Karagiannis TC, El-Osta A. The paradox of histone deacetylase inhibitor-mediated modulation of cellular responses to radiation. Cell Cycle 2006;5:288295.[Medline]
- Ito K, Barnes PJ, Adcock IM. Glucocorticoid receptor recruitment of histone deacetylase 2 inhibits interleukin-1beta-induced histone h4 acetylation on lysines 8 and 12. Mol Cell Biol 2000;20:68916903.[Abstract/Free Full Text]
- Mosley AL, Ozcan S. Glucose regulates insulin gene transcription by hyperacetylation of histone h4. J Biol Chem 2003;278:1966019666.[Abstract/Free Full Text]
- Ito K, Caramori G, Lim S, Oates T, Chung KF, Barnes PJ, Adcock IM. Expression and activity of histone deacetylases in human asthmatic airways. Am J Respir Crit Care Med 2002;166:392396.[Abstract/Free Full Text]
- Bayram H, Devalia JL, Sapsford RJ, Ohtoshi T, Miyabara Y, Sagai M, Davies RJ. The effect of diesel exhaust particles on cell function and release of inflammatory mediators from human bronchial epithelial cells in vitro. Am J Respir Cell Mol Biol 1998;18:441448.[Abstract/Free Full Text]
- Diaz-Sanchez D, Jyrala M, Ng D, Nel A, Saxon A. In vivo nasal challenge with diesel exhaust particles enhances expression of the cc chemokines rantes, mip-1alpha, and mcp-3 in humans. Clin Immunol 2000;97:140145.[CrossRef][Medline]
- Tsatsanis C, Androulidaki A, Venihaki M, Margioris AN. Signalling networks regulating cyclooxygenase-2. Int J Biochem Cell Biol 2006;38:16541661.[CrossRef][Medline]
- Lander HM. An essential role for free radicals and derived species in signal transduction. FASEB J 1997;11:118124.[Abstract]
- Gavett SH, Madison SL, Chulada PC, Scarborough PE, Qu W, Boyle JE, Tiano HF, Lee CA, Langenbach R, Roggli VL, et al. Allergic lung responses are increased in prostaglandin h synthase-deficient mice. J Clin Invest 1999;104:721732.[Medline]
- Galasinski SC, Resing KA, Goodrich JA, Ahn NG. Phosphatase inhibition leads to histone deacetylases 1 and 2 phosphorylation and disruption of corepressor interactions. J Biol Chem 2002;277:1961819626.[Abstract/Free Full Text]
- Li X, Song S, Liu Y, Ko SH, Kao HY. Phosphorylation of the histone deacetylase 7 modulates its stability and association with 143-3 proteins. J Biol Chem 2004;279:3420134208.[Abstract/Free Full Text]
- Colombo R, Boggio R, Seiser C, Draetta GF, Chiocca S. The adenovirus protein gam1 interferes with sumoylation of histone deacetylase 1. EMBO Rep 2002;3:10621068.[CrossRef][Medline]
- David G, Neptune MA, DePinho RA. Sumo-1 modification of histone deacetylase 1 (hdac1) modulates its biological activities. J Biol Chem 2002;277:2365823663.[Abstract/Free Full Text]
- Seigneurin-Berny D, Verdel A, Curtet S, Lemercier C, Garin J, Rousseaux S, Khochbin S. Identification of components of the murine histone deacetylase 6 complex: link between acetylation and ubiquitination signaling pathways. Mol Cell Biol 2001;21:80358044.[Abstract/Free Full Text]
- Zhou Q, Melkoumian ZK, Lucktong A, Moniwa M, Davie JR, Strobl JS. Rapid induction of histone hyperacetylation and cellular differentiation in human breast tumor cell lines following degradation of histone deacetylase-1. J Biol Chem 2000;275:3525635263.[Abstract/Free Full Text]
- Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin SC, Heyman RA, Rose DW, Glass CK, et al. A cbp integrator complex mediates transcriptional activation and ap-1 inhibition by nuclear receptors. Cell 1996;85:403414.[CrossRef][Medline]
- Shringarpure R, Grune T, Mehlhase J, Davies KJ. Ubiquitin conjugation is not required for the degradation of oxidized proteins by proteasome. J Biol Chem 2003;278:311318.[Abstract/Free Full Text]
- Ito K, Hanazawa T, Tomita K, Barnes PJ, Adcock IM. Oxidative stress reduces histone deacetylase 2 activity and enhances il-8 gene expression: Role of tyrosine nitration. Biochem Biophys Res Commun 2004;315:240245.[CrossRef][Medline]
- Fasanaro P, Magenta A, Zaccagnini G, Cicchillitti L, Fucile S, Eusebi F, Biglioli P, Capogrossi MC, Martelli F. Cyclin d1 degradation enhances endothelial cell survival upon oxidative stress. FASEB J 2006;20:12421244.[Abstract/Free Full Text]
- Barnes PJ, Adcock IM, Ito K. Histone acetylation and deacetylation: importance in inflammatory lung diseases. Eur Respir J 2005;25:552563.[Abstract/Free Full Text]
- Appleby SB, Ristimaki A, Neilson K, Narko K, Hla T. Structure of the human cyclo-oxygenase-2 gene. Biochem J 1994;302:723727.[Medline]
- Inoue H, Yokoyama C, Hara S, Tone Y, Tanabe T. Transcriptional regulation of human prostaglandin-endoperoxide synthase-2 gene by lipopolysaccharide and phorbol ester in vascular endothelial cells. Involvement of both nuclear factor for interleukin-6 expression site and camp response element. J Biol Chem 1995;270:2496524971.[Abstract/Free Full Text]
- Takizawa H, Ohtoshi T, Kawasaki S, Kohyama T, Desaki M, Kasama T, Kobayashi K, Nakahara K, Yamamoto K, Matsushima K, et al. Diesel exhaust particles induce nf-kappa b activation in human bronchial epithelial cells in vitro: Importance in cytokine transcription. J Immunol 1999;162:47054711.[Abstract/Free Full Text]
- Deng WG, Zhu Y, Wu KK. Role of p300 and pcaf in regulating cyclooxygenase-2 promoter activation by inflammatory mediators. Blood 2004;103:21352142.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
D. Adenuga, H. Yao, T. H. March, J. Seagrave, and I. Rahman
Histone Deacetylase 2 Is Phosphorylated, Ubiquitinated, and Degraded by Cigarette Smoke
Am. J. Respir. Cell Mol. Biol.,
April 1, 2009;
40(4):
464 - 473.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. C. Degner, A. J. Papoutsis, O. Selmin, and D. F. Romagnolo
Targeting of Aryl Hydrocarbon Receptor-Mediated Activation of Cyclooxygenase-2 Expression by the Indole-3-Carbinol Metabolite 3,3'-Diindolylmethane in Breast Cancer Cells
J. Nutr.,
January 1, 2009;
139(1):
26 - 32.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-L. Wang, Y.-C. Lee, W.-M. Yang, W.-C. Chang, and J.-M. Wang
Sumoylation of LAP1 is involved in the HDAC4-mediated repression of COX-2 transcription
Nucleic Acids Res.,
November 1, 2008;
36(19):
6066 - 6079.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Brant and J. P. Fabisiak
Nickel Alterations of TLR2-Dependent Chemokine Profiles in Lung Fibroblasts Are Mediated by COX-2
Am. J. Respir. Cell Mol. Biol.,
May 1, 2008;
38(5):
591 - 599.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2007 American Thoracic Society.
|