help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Published ahead of print on May 16, 2007, doi:10.1165/rcmb.2006-0268OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2006-0268OCv1
37/3/366    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tephly, L. A.
Right arrow Articles by Carter, A. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tephly, L. A.
Right arrow Articles by Carter, A. B.
American Journal of Respiratory Cell and Molecular Biology. Vol. 37, pp. 366-374, 2007
© 2007 American Thoracic Society
DOI: 10.1165/rcmb.2006-0268OC

Differential Expression and Oxidation of MKP-1 Modulates TNF-{alpha} Gene Expression

Linda A. Tephly and A. Brent Carter

Department of Medicine, University of Iowa Roy J. and Lucille A. Carver College of Medicine; and Iowa City Veterans Administration Medical Center, Iowa City, Iowa

Correspondence and requests for reprints should be addressed to A. Brent Carter, M.D., Division of Pulmonary and Critical Care Medicine, C33 GH, University of Iowa Hospital and Clinics, 200 Hawkins Drive, Iowa City, IA 52242. E-mail: brent-carter{at}uiowa.edu


   Abstract
Top
 Abstract
CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Monocytic cells are integral in the pathogenesis of inflammatory disorders. We have shown previously that asbestos-induced p38 mitogen-activated protein (MAP) kinase activation and TNF-{alpha} expression are mediated by H2O2 in blood monocytes. Due to the high expression and activity of catalase and glutathione peroxidase, normal alveolar macrophages do not respond in a manner similar to that of blood monocytes. Since kinase activity is tightly regulated by phosphatases, we hypothesized that the dual specificity phosphatase MAP kinase phosphatase (MKP)-1 regulates p38 activity and TNF-{alpha} production in alveolar macrophages due to insufficient H2O2 generation in response to asbestos. We found that MKP-1 was highly expressed in alveolar macrophages, while blood monocytes had minimal expression. Inhibition of expression and activity of MKP-1 or overexpression of a catalytic mutant MKP-1 recovered p38 activity in alveolar macrophages. We questioned whether MKP-1 oxidation played a role dictating the contrasting responses of these cells to asbestos exposure, and found that overexpressed wild-type MKP-1 in monocytes was oxidized, while the mutant MKP-1 remained in the reduced form. Monocytes overexpressing either catalase or wild-type MKP-1 had decreased p38 activation and TNF-{alpha} production, respectively. In addition, TNF-{alpha} gene expression was regained in alveolar macrophages overexpressing the catalytic mutant MKP-1. These data suggest that MKP-1, through increased expression and lack of oxidation, modulates the inflammatory response in alveolar macrophages exposed to asbestos.

Key Words: asbestosis • monocytes • hydrogen peroxide • MKP-1 • TNF-{alpha}



   CLINICAL RELEVANCE
Top
 Abstract
 CLINICAL RELEVANCE
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Asbestos is known to induce H2O2, and the release of TNF by alveolar macrophages in patients with asbestosis plays an integral role in the pathogenesis of the disease. These studies link H2O2 generation to TNF production after exposure to asbestos.

 
Macrophages are involved in the pathogenesis of inflammatory disorders in the lung. A hallmark of this inflammatory response is the production of proinflammatory cytokines. One characteristic feature of alveolar macrophages obtained from patients with chronic lung disorders, such as asbestosis, is that they spontaneously release cytokines (1–3). The release of cytokines, especially TNF-{alpha}, is associated with the development of interstitial fibrosis. These inflammatory processes are also associated with the generation of reactive oxygen species (ROS), which may induce disease progression and can result in further injury when produced in high levels (4–6). On the other hand, small alterations in ROS, especially the generation of H2O2, can serve as an important second messenger.

H2O2 has several characteristics that suggest it is an important second messenger. These characteristics include being generated rapidly after a stimulus, the ability to diffuse within the cell and across the cell membrane, reacting at specific sites, and being degraded enzymatically. In addition, H2O2 is electrically neutral and has a longer half-life than other ROS (7). We have previously demonstrated that H2O2 is necessary for TNF-{alpha} gene expression in blood monocytes exposed to asbestos and that normal alveolar macrophages have limited H2O2-mediated signaling secondary to high catalase and glutathione peroxidase activity (8). Although asbestos is known to induce cytokine production, there is limited data on the upstream signaling pathways, especially as it relates to H2O2, linking asbestos to cytokine gene expression.

The mitogen-activated protein (MAP) kinases are a family of second messengers that are essential for transferring signals from the cell surface to the nucleus. Multiple studies have demonstrated that MAP kinases are activated by asbestos (8–10) and by ROS (4, 8, 11–14). These studies also show that both superoxide anion (O2.-) and H2O2 act as mediators of MAP kinase activation. In some studies, the direct mechanism by which ROS activate MAP kinases appears to be via the classically described pathways (4, 14). We have demonstrated that H2O2 is the signaling mediator for p38 MAP kinase activation in blood monocytes exposed to asbestos (8), but we did not determine the molecular mechanism(s) of H2O2-mediated signaling.

The modulation of MAP kinase activity by dual-specificity MAP kinase phosphatases (MKPs) is an important mechanism of regulating the transfer of signals from the cell surface to the nucleus. The MKPs, which are a subgroup of the protein tyrosine phosphatases (PTPs), are phosphatases that have a common structure with a carboxyl-terminal catalytic domain and an amino-terminal noncatalytic domain that is responsible for binding with MAP kinase substrates (15, 16). These enzymes are capable of dephosphorylating both phosphotyrosine and phosphothreonine residues. MKP-1 is one such dual-specificity phosphatase that is transcribed from an immediate-early gene, and its expression is regulated by tyrosine kinases and protein kinase C, depending on the cell type (17, 18). Although MKP-1 can dephosphorylate extracellular signal–regulated kinase (ERK), c-Jun NH2-terminal kinase (JNK), and p38, several studies have demonstrated that the p38 MAP kinase is the preferred substrate for MKP-1 (19–23).

The regulation of MKP-1 expression and activity are quite distinct from one another. Studies have shown that MKP-1 can be modulated at both the transcriptional and translational level (17, 18, 24–28). In addition to the studies showing the requirement of tyrosine kinases and protein kinase C (17, 18, 24), one study has shown that an increase in MKP-1 expression requires an active p38 MAP kinase (26). Another study demonstrated that the generation of O2.- or treatment with H2O2 induced the expression of MKP-1 (17).

Similar to other PTPs, MKP-1 contains an essential cysteine (Cys-258) in the catalytic domain that is a target of oxidation, and the activity of MKP-1 revolves around the redox state of the catalytic cysteine, Cys-258. Oxidation of the catalytic cysteine results in inactivation of the phosphatase (29–32). Micromolar concentrations of H2O2 have been shown to oxidize the catalytic cysteines in PTPs and MKPs (29, 30, 33, 34). In addition, MKP-1, once oxidized, undergoes rapid degradation in the proteasome (33).

Due to the fact that normal alveolar macrophages have limited H2O2-mediated signaling due to high levels and activity of catalase and GPx (8), in this article we ask if MKP-1 plays a role in regulating p38 MAP kinase activity and TNF-{alpha} gene expression in alveolar macrophages compared with blood monocytes exposed to asbestos. Specifically, we hypothesized that MKP-1, in part, regulates p38 activity in alveolar macrophages in response to asbestos exposure secondary to their high catalase and GPx activity. We found that MKP-1 was highly expressed in alveolar macrophages, and the level of expression increased with exposure to asbestos. In contrast, blood monocytes had minimal MKP-1 protein expression. When protein translation was inhibited with cycloheximide or triptolide or MKP-1 activity was inhibited with NaVO4, p38 activity was recovered in alveolar macrophages. In addition, macrophages overexpressing a mutant MKP-1 that had the catalytic cysteine converted to a serine had increased p38 activity after exposure to asbestos. To determine if MKP-1 oxidation was different in these cells, we separated oxidized and reduced forms of MKP-1. We found that most of the wild-type MKP-1 expressed in monocytes was oxidized. Furthermore, over expression of the H2O2-degrading enzyme catalase in monocytes inhibited p38 MAP kinase activation. To provide biological relevance of MKP-1 after asbestos exposure, we found that overexpression of wild-type MKP-1 in monocytes reduced gene expression driven by a TNF-{alpha} promoter, while overexpression of MKP-1 (C258S) in macrophages increased gene expression. These novel data suggest that MKP-1, through increased expression and lack of oxidation, regulates p38 MAP kinase activity and TNF-{alpha} gene expression in alveolar macrophages, and provides a mechanistic explanation of why blood monocytes, rather than alveolar macrophages, produce TNF-{alpha} when exposed to asbestos.


   MATERIALS AND METHODS
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 References
 
Cells
The Human Subjects Review Board of the University of Iowa Carver College of Medicine approved the protocol of obtaining alveolar macrophages and blood monocytes by bronchoalveolar lavage and by phlebotomy, respectively, from normal volunteers. Normal volunteers had to meet the following criteria: (1) age between 18 and 45 years; (2) no history of cardiopulmonary disease or other chronic disease; (3) no prescription or nonprescription medication except oral contraceptives; (4) no recent or current evidence of infection; and (5) lifetime nonsmoker. Fiberoptic bronchoscopy with bronchoalveolar lavage was performed after subjects received intramuscular atropine, 0.6 mg, and local anesthesia. Three subsegments of the lung were lavaged with five 20-ml aliquots of normal saline, and the first aliquot in each was discarded. The percentage of alveolar macrophages was determined by Wright-Giemsa stain and varied from 90 to 98%. Blood monocytes were obtained by phlebotomy and were isolated by Ficoll-gradient centrifugation. Cells were plated in serum-free RPMI 1640 (Gibco, Carlsbad, CA) and allowed to adhere for 1 hour before experiments. For some of the experiments, a human monocyte cell line, THP-1 cells, and a macrophage cell line, RAW 264.7 cells, which were obtained from American Type Cell Culture (Mannassas, VA), were used. THP-1 cells and RAW 264.7 cells were maintained in RPMI 1640 or Dulbecco's modified Eagle's medium, respectively, supplemented with gentamicin and 10% fetal bovine serum.

Plasmids and Transfections
TNF-{alpha} gene expression was evaluated utilizing the –600 TNF-{alpha}-CAT plasmid (a generous gift from Dr. Tom Maniatis, Harvard University, Cambridge, MA), or the TNF-{alpha}-luc plasmid (a generous gift from Dr. Dmitry V. Kuprash, Russian Academy of Sciences, Moscow, Russia), both of which have been previously described (35, 36). The pRKF-Flag-MKP1 and the pRKF-Flag-MKP1 (C258S) plasmids (generous gifts from Dr. Michael Karin, University of San Diego, La Jolla, CA) have been previously described (33). Transfections were performed using the Fugene transfection reagent (Roche, Indianapolis, IN), according to the manufacturer's instructions. After 24 hours, the cells were exposed to 10 µg/cm2 crocidolite asbestos (NAIMA Fiber Repository), and luciferase activity was measured using the Dual Luciferase Activity Assay (Promega, Madison, WI) with normalizing transfection efficiency to Renilla luciferase expression after 6 hours. Chloramphenicol acetyltransferase (CAT) assays, which were normalized to total protein, were performed after 24 hours of exposure to crocidolite asbestos. Cells were harvested in 0.25 M Tris and were incubated at 60°C for 30 minutes. Supernatants were incubated with 0.1 µCi of [14C] chloramphenicol and 1.0 mM acetyl coenzyme A for 2 hours. Acetylated derivatives (CM3-AC and CM1-AC) were separated from nonacetylated chloramphenicol (CM) by ascending thin layer chromatography in chloroform/methanol (95:5) solvent. CAT activity was determined by autoradiography.

Western Blot Analysis
Whole cell lysates were prepared by harvesting the cells after exposing to crocidolite asbestos for the indicated amount of time and resuspending in lysis buffer (1% NP-40, 0.15 M NaCl, 0.05 M Tris [pH 7.4], EDTA-free protease inhibitors (Roche), and phosphatase inhibitor cocktail (Calbiochem, La Jolla, CA). Samples were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), and gels were transferred to polyvinylidene difluoride membranes (Amersham Pharmacia Biotech, Piscataway, NJ). The p-p38 monoclonal was obtained from Cell Signaling (Danvers, MA), and the p38, MKP-1, and Flag polyclonal antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). In certain experiments, cyclohexamide, sodium vanadate, or triptolide were used at concentrations of 20 µg/ml, 1 mM, and 0.5 µM, respectively.

Real-Time PCR
Total RNA was isolated using the Absolutely RNA RT-PCR Miniprep kit (Stratagene, Cedar Creek, TX), according to the manufacturer's instructions. Total RNA (1 µg) was reverse transcribed to cDNA using iScript (Bio-Rad, Hercules, CA) or RETROScript (Ambion, Austin, TX), according to the manufacturer's instructions. PCR was performed by adding 2 µl of cDNA with 48 µl of Sybr Green Supermix (Bio-Rad), according to manufacturer's instructions. Amplification was then performed in a Bio-Rad iCycler iQ Fluorescence Thermocycler as follows: 3 minutes at 95°C, followed by 45 cycles of 20 seconds at 95°C, 20 seconds at 60°C, 20 seconds at 72°C, and 10 seconds at 3°C below the melting temperature for each amplimer. Fluorescence data were captured to ensure that primer dimers were not contributing to the fluorescence signal generated with SYBR Green I DNA dye. Specificity of the amplification was confirmed using melting curve analysis. Data were collected and recorded by Bio-Rad iCycler iQ software and expressed as a function of threshold cycle (Ct), which is the cycle at which the fluorescence intensity in a given reaction tube rises above background. The gene-specific Ct for each sample was corrected by subtracting the Ct for hypoxanthine phosphoribosyltransferase (HPRT) ({Delta}Ct). Untreated controls were chosen as the reference samples, and the {Delta}Ct for all experimental samples were subtracted by the {Delta}Ct for the control samples ({Delta}{Delta}Ct). Finally, sample mRNA steady-state levels, relative to control mRNA levels, were calculated by the formula 2–({Delta}{Delta}Ct). Specific primer sets used for human MKP-1, TNF-{alpha}, and the HPRT housekeeping genes are as follows (5' to 3'): MKP-1 sense, TTTCTGTACCTGGGCAGTGCGTAT; MKP-1 antisense, ATGCTTCGCCTCTGCTTCACAAAC; TNF-{alpha} sense, CAGCCTCTTCTCCTTCCTGA; TNF-{alpha} antisense, AGCCTTGGCCCTTGAAGA; HPRT sense, TTGGAAAGGGTGTTTATTCCTC; and HPRT antisense, TCCCCTGTTGACTGGTCATT. Primers were selected based on nucleotide sequences downloaded from the National Center for Biotechnology Information data bank and designed with software by Integrated DNA Technologies (Coralville, IA).

MKP-1 Oxidation Assay
To prevent degradation of MKP-1 by the proteosome, cells were cultured with 50 µM MG-132 for 15 minutes before exposing to crocidolite asbestos. Cells were harvested after 2 hours and were resuspended in lysis buffer containing 20 mM Tris-HCL (pH 7.4), 1% Triton X-100, 10 mM N-ethylmaleimide (NEM), and EDTA-free protease inhibitors. In some experiments, THP-1 cells were infected with 500 moi of the replicative-deficient adenoviral vectors, Ad.5-CMVempty or Ad.5-Catalase (Viraquest, North Liberty, IA), for 48 hours before crocidolite treatment. Samples were separated by SDS-PAGE and gels were transferred to polyvinylidene difluoride membranes. Western blot analysis was performed with the MKP-1 polyclonal antibody in the presence or absence of 250 mM beta-mercaptoethanol (betaME).

Phosphatase Assay
Whole cell lysates were prepared by harvesting the cells as above described without the phosphatase inhibitor cocktail. Twenty micrograms of lysate was incubated with 10 ng of active p38-{alpha} kinase (Stratagene) for 20 minutes at 37°C. Samples were separated by SDS-PAGE, and Western analysis was performed using the p-p38 monoclonal antibody. In some experiments, MKP-1 was immunoprecipitated from the lysate before the incubation with the active p38-{alpha} kinase.

Statistical Analysis
Statistical comparisons were performed using an unpaired, one-tailed t test. Values in figures are expressed as means with standard error, with the probability of P < 0.05 considered to be significant.


   RESULTS
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 References
 
The p38 MAP Kinase Is Activated in Blood Monocytes after Exposure to Asbestos
Our previous work had only short exposures to asbestos in vitro (8), so we first wanted to determine if longer exposures had any different effect on p38 MAP kinase activation. Human blood monocytes and human alveolar macrophages were cultured in the presence or absence of crocidolite asbestos for 1 to 2 hours. A Western analysis for p-p38 revealed that blood monocytes had more phosphorylated p38 at baseline compared with alveolar macrophages, and monocytes also had a time-dependent increase in phosphorylation of p38 after exposure to asbestos. In contrast, p38 MAP kinase activity, as measured by the presence of the phosphorylated form of the kinase, was essentially absent in alveolar macrophages, even after 2 hours of stimulation (Figure 1A).


Figure 1
View larger version (25K):
[in this window]
[in a new window]

  		Figure 1. The p38 MAP kinase is activated in blood monocytes stimulated with crocidolite asbestos. Human alveolar macrophages and blood monocytes were exposed to 10 µg/cm2 crocidolite asbestos for the designated amount of time. (A) Whole cell lysates were separated by SDS-PAGE. (B) Whole cell lysates (20 µg) were incubated at 37°C for 20 minutes with 10 ng of active p38-{alpha} kinase. Samples were separated by SDS-PAGE. In A and B, Western blot analysis was performed with p-p38 monoclonal antibody and the p38 rabbit polyclonal antibody to determine activation and equal loading of the proteins, respectively.

 
One plausible mechanism that may result in an inactive p38 in alveolar macrophages is the presence of a phosphatase that specifically inactivates p38 by dephosphorylation. To investigate this mechanism, we cultured human alveolar macrophages and blood monocytes in the presence or absence of crocidolite asbestos for 2 hours and then incubated active p38-{alpha} kinase with the cell lysates at 37°C. A Western analysis revealed that alveolar macrophages had significant dephosphorylation of the active p38-{alpha} kinase in cells exposed to crocidolite asbestos, while blood monocytes had a significant increase in phosphorylation (Figure 1B). These results suggest that blood monocytes activate the p38 MAP kinase after exposure to crocidolite asbestos, and alveolar macrophages inactivate p38 by dephosphorylation below control levels. In addition, these data suggest that a phosphatase is, at least in part, responsible for dephosphorylation and inactivation of p38 in alveolar macrophages.

Alveolar Macrophages Have Increased Expression of the Dual-Specificity Phosphatase MKP-1
Since kinase activity is tightly regulated by phosphatases, we ask if the p38 MAP kinase was inactivated in alveolar macrophages by a dual-specificity phosphatase. We investigated the role of MKP-1 due to the fact that the p38 MAP kinase is the preferred substrate for this phosphatase (19–23, 37). We first determined the steady-state levels of MKP-1 mRNA, since MKP-1 is transcribed from an immediate-early gene. Human alveolar macrophages and blood monocytes were exposed to crocidolite asbestos for 3 hours, and total RNA was isolated and reverse transcribed. Real-time PCR was used to measure MKP-1 mRNA steady-state levels in cells exposed to asbestos. Alveolar macrophages accumulated significantly more MKP-1 mRNA, both at baseline and after exposure to crocidolite asbestos, than blood monocytes, but exposure to crocidolite did not significantly alter mRNA accumulation (Figure 2A). Blood monocytes, however, had a slight increase in MKP-1 mRNA with crocidolite treatment. These data indicate that human alveolar macrophages have increased steady-state levels of MKP-1 mRNA compared with blood monocytes.


Figure 2
View larger version (40K):
[in this window]
[in a new window]

  		Figure 2. Alveolar macrophages express more MKP-1 than do blood monocytes. (A) Human alveolar macrophages and blood monocytes were cultured in the presence or absence of 10 µg/cm2 crocidolite asbestos for 3 hours. Total RNA was isolated and reverse transcribed to cDNA. Real-time PCR amplification was performed as described in MATERIALS AND METHODS. Data are expressed as MKP-1 mRNA expression (fold) relative to the control in blood monocytes. For statistical analysis, * denotes a comparison of controls (P < 0.0004) and ** denotes a comparison of crocidolite (alveolar macrophages to blood monocytes) (P < 0.0003). (B) Human alveolar macrophages and blood monocytes were exposed to 10 µg/cm2 crocidolite asbestos for the designated amount of time. Whole cell lysates were separated by SDS-PAGE, and Western blot analysis was performed with the MKP-1 rabbit polyclonal antibody or the beta-actin monoclonal antibody to determine expression and equal loading of the proteins, respectively.

 
Due to the dramatic differences in levels of MKP-1 mRNA, we next determined if this difference in message resulted in differences in protein expression. Human alveolar macrophages and blood monocytes were exposed to asbestos for the designated amount of time. We found that blood monocytes had minimal expression of MKP-1 that was only slightly present at 15 minutes. Alveolar macrophages had significantly greater protein expression at baseline that was increased with exposure to asbestos (Figure 2B). Contrary to the real-time PCR data, exposure to crocidolite asbestos significantly increased MKP-1 protein expression in human alveolar macrophages, suggesting that translation of MKP-1 is a critical step in regulating MKP-1 expression. Equal loading of the proteins in blood monocytes and alveolar macrophages was determined by beta-actin expression in each cell type.

An Inactive MKP-1 Results in Recovery of p38 MAP Kinase Activity in Alveolar Macrophages
Based on the above data suggesting that MKP-1 expression was primarily regulated at the level of translation, we investigated whether inhibition of translation with cyclohexamide (CHX) or inhibition of phosphatase activity with sodium vanadate (NaVO4) would permit p38 activation in alveolar macrophages exposed to asbestos. Human alveolar macrophages were cultured in the presence or absence of CHX or NaVO4 for 30 minutes before exposing the cells to crocidolite asbestos for 2 hours. Western blot analysis for phosphorylated p38 demonstrated that alveolar macrophages treated with either CHX or NaVO4 had increased p38 phosphorylation after exposure to asbestos (Figure 3A). Phosphorylated p38 in cells exposed to crocidolite alone was absent, as expected. In addition, cells treated with CHX had no expression of MKP-1 (Figure 3A), which supports our hypothesis that MKP-1 is, in part, responsible for the inactive p38 in alveolar macrophages.


Figure 3
View larger version (43K):
[in this window]
[in a new window]

  		Figure 3. Inhibition, removal, or overexpression of a mutant MKP-1 in alveolar macrophages recovers p38 MAP kinase activity. (A) Human alveolar macrophages were cultured in the presence or absence of 20 µg cyclohexamide (CHX) or 1 mM NaVO4 for 30 minutes before exposing cells to 10 µg/cm2 crocidolite asbestos for 2 hours. (B) Human alveolar macrophages were cultured in the presence or absence of Triptolide 0.5 µM before being exposed to 10 µg/cm2 crocidolite asbestos for 2 hours. (C) Human alveolar macrophages were exposed to 10 µg/cm2 crocidolite asbestos for the designated amount of time. Whole cell lysates were subjected to immunoprecipitation with the MKP-1 rabbit polyclonal antibody. After immunoprecipitation, the immunodepleted lysates (20 µg) were incubated at 37°C for 20 minutes with 10 ng of active p38-{alpha} kinase. In A, B, and C, Western blot analysis was performed with p-p38 monoclonal antibody and the p38 rabbit polyclonal antibody to determine activation and equal loading of the proteins, respectively, and with the MKP-1 rabbit polyclonal antibody to confirm the inhibition of expression and equal loading of immunoprecipitated proteins, respectively.

 
To evaluate the effect of MKP-1 on p38 activation in another way, we cultured alveolar macrophages with triptolide, which blocks induction of MKP-1. Human alveolar macrophages were cultured for 30 minutes in the presence or absence of 0.5 µM of triptolide, which was determined to be the optimal inhibitory dose that was not toxic to the cells, before exposing the cells to crocidolite asbestos for 2 hours. We found that triptolide blocked expression of MKP-1 in alveolar macrophages, and p38 was significantly activated with crocidolite asbestos in cells treated with triptolide (Figure 3B). Similar to CHX, cells treated with triptolide did not express MKP-1. Taken together, these data demonstrate that blocking the expression of MKP-1 or inhibiting its phosphatase activity results in activation of p38 in alveolar macrophages exposed to asbestos.

To further confirm that MKP-1 was responsible for the dephosphorylation and inactivation of p38 in alveolar macrophages, we obtained lysates from human alveolar macrophages exposed to crocidolite asbestos over a time course up to 2 hours. The lysates were subjected to immunoprecipitation with the MKP-1 antibody. The immunodepleted lysates were then incubated with the active p38-{alpha} kinase at 37oC, and the samples were separated by SDS-PAGE. We found that removal of MKP-1 by immunoprecipitation resulted in the presence of phosphorylated p38-{alpha} that significantly increased in a time-dependent manner (Figure 3C). In aggregate, these data demonstrate that human alveolar macrophages have increased expression of MKP-1 that regulates p38 MAP kinase phosphorylation after exposure to crocidolite asbestos.

Due to the significant differences in MKP-1 expression and p38 activation between the cells after exposure to asbestos, we ask if these differences were secondary to a disproportion in MKP-1 oxidation, which inactivates the phosphatase. We determined if MKP-1 was oxidized in monocytes by performing an electrophoretic mobility shift assay. THP-1 monocytes were transfected with either wild-type (wt) Flag-MKP-1 or the Flag-MKP-1 (C258S) mutant. After 24 hours, we treated the cells with a proteasome inhibitor, MG132, since MKP-1 is rapidly degraded in the proteasome after oxidation (33) in order that we would be able to detect differences in the oxidized and reduced form of MKP-1. Cells were then exposed to asbestos for 2 hours, and lysates were prepared in a buffer containing N-ethylmaleimide to allow the formation of disulfides when MKP-1 is oxidized. Whole cell lysates were separated by SDS-PAGE, and Western blot analysis for Flag-tagged MKP-1 was performed. We found that lysates obtained from cells expressing wt Flag-MKP-1 had a shift in electrophoretic mobility of Flag-MKP-1 to a high molecular weight form that only slightly entered the gel (Figure 4A). Cells exposed to crocidolite asbestos had an increase in oxidized form of Flag-MKP-1. In contrast, this electrophoretic mobility shift of Flag-MKP-1was absent in lysates obtained from cells expressing the mutant MKP-1 (C258S), in which the catalytic cysteine was converted to a serine (Figure 4A). Equal loading of proteins was confirmed by performing a Western blot analysis for beta-actin. These data suggest that monocytes oxidize MKP-1, which renders it inactive after exposure to asbestos.


Figure 4
View larger version (38K):
[in this window]
[in a new window]

  		Figure 4. MKP-1 is oxidized in monocytes exposed to asbestos. (A) THP-1 monocytes were transfected with either wild-type (wt) Flag-MKP-1 or mutant Flag-MKP-1 (C258S). After 24 hours, cells were treated with MG-132 for 15 minutes and then exposed to 10 µg/cm2 crocidolite asbestos for 2 hours. Whole cell lysates were prepared using a non-reducing buffer containing 20 mM Tris-HCl (pH 7.4), 1% Triton X-100, 10 mM N-ethylmaleimide, and protease inhibitors. Western blot analysis was performed with the Flag rabbit polyclonal antibody or the beta-actin monoclonal antibody to determine the oxidation (Ox) and reduction (Red) of MKP-1 and equal loading of the proteins, respectively. The oxidized form of Flag-MKP-1 barely entered the gel, and the reduced form ran at 38 kD. (B) RAW 264.7 macrophages were transiently co-transfected with pTRE-luc, pTET-ATF, and either an empty vector or pRKF-Flag-MKP-1 (C258S) and a Renilla luciferase plasmid. After 24 hours, cells were exposed to 10 µg/cm2 crocidolite asbestos for 6 hours. Luciferase activity, which was normalized to Renilla luciferase expression, is expressed in Real Light Units. For statistical comparisons, * denotes comparison of control (Vector) to control (MKP-1 (C258S)) (P < 0.0070), and ** denotes comparison of crocidolite (Vector) to crocidolite (MKP-1 (C258S)) (P < 0.0185). (C) THP-1 monocytes were infected with a replication-deficient adenovirus vector expressing either an empty vector (Ad.CMV) or a human catalase expression vector (Ad.CAT) at 500 moi. After 48 hours, the cells were exposed to 10 µg/cm2 crocidolite asbestos for 2 hours. Whole cell lysates were separated by SDS-PAGE, and a Western blot analysis was performed with p-p38 monoclonal antibody and the p38 rabbit polyclonal antibody to determine activation and equal loading of the proteins, respectively.

 
In order to support the notion that oxidation of MKP-1 is necessary for p38 activation and to avoid the possible non-specific effects of CHX and triptolide, we performed an in vivo p38 MAP kinase assay in RAW 264.7 cells, a murine macrophage cell line that has many of the features of primary alveolar macrophages (38, 39). In this assay, when ATF is phosphorylated by the p38 MAP kinase, the phosphorylated ATF can bind to the tetracycline-response element (TRE) in the luciferase reporter promoter to induce luciferase expression. RAW 264.7 cells were co-transfected with the TRE luciferase reporter plasmid, pTET-ATF, and either an empty vector or the mutant Flag-MKP-1 (C258S) expression vector. After 24 hours, the cells were exposed to crocidolite asbestos for 6 hours, and luciferase activity was determined and normalized to Renilla luciferase expression. We found that cells expressing the mutant MKP-1 had a greater than 5-fold increase in luciferase activity after exposure to asbestos, while cells expressing the empty vector where no different than control (Figure 4B). There was also a significant increase in luciferase activity in cells expressing the mutant MKP-1 that were cultured in the absence of asbestos. In aggregate, these data suggest that the expression and activity of MKP-1 regulates the activation of p38 in alveolar macrophages, in contrast to blood monocytes, which have minimal expression of MKP-1.

To evaluate if MKP-1 oxidation was due to the disparity in H2O2 availability, we infected THP-1 monocytes with a replicative-deficient adenovirus containing either an empty vector (Ad.CMV) or a catalase expression vector (Ad.CAT). After 48 hours, cells were exposed to crocidolite asbestos for 2 hours. Lysates were separated by SDS-PAGE, and a Western blot analysis showed a robust increase in p38 phosphorylation in cells expressing the empty vector, while cells overexpressing catalase had a significant decrease in the phosphorylated p38 (Figure 4C). In aggregate, these data suggest that monocytes have greater availability of H2O2 to oxidize MKP-1 after exposure to asbestos. These data also indicate that p38 MAP kinase activation in monocytes exposed to asbestos is, in part, due to the oxidation of MKP-1.

Monocytes Have Increased TNF-{alpha} Gene Expression after Stimulation with Crocidolite Asbestos
In order to provide some biologic relevance to the dissimilarity in MKP-1 expression and oxidation and p38 MAP kinase activation, we investigated the expression of TNF-{alpha} in cells exposed to asbestos. Human alveolar macrophages and blood monocytes were cultured in the presence or absence of crocidolite asbestos for 3 hours, and total RNA was isolated and reverse transcribed. Real-time PCR was used to measure steady-state levels of TNF-{alpha} mRNA in cells exposed to asbestos. We found that blood monocytes had a significant increase in TNF-{alpha} mRNA with asbestos exposure, while the TNF-{alpha} mRNA levels in alveolar macrophages were no different than that in controls (Figure 5A).


Figure 5
View larger version (33K):
[in this window]
[in a new window]

  		Figure 5. Blood monocytes stimulated with crocidolite asbestos produce TNF-{alpha}. (A) Human alveolar macrophages and blood monocytes were exposed to crocidolite asbestos for 3 hours. Total RNA was isolated and reverse-transcribed to cDNA. Real-time PCR amplification was performed as described in MATERIALS AND METHODS. Data are expressed as TNF-{alpha} mRNA expression (fold) relative to the control in blood monocytes. For statistical analysis, * denotes a comparison of control to crocidolite in blood monocytes and crocidolite (blood monocytes to alveolar macrophages) (P < 0.0014). (B) THP-1 cells were transiently co-transfected with the -600 TNF-{alpha}-CAT reporter plasmid and either an empty vector or pRKF-Flag-MKP-1 expression vector. After 24 hours, cells were exposed to 10 µg/cm2 crocidolite asbestos for 24 hours. Whole cell lysates, which were normalized to protein, were incubated with 0.1 µCi of [14C] chloramphenicol and 1.0 mM acetyl coenzyme A for 2 hours at 37°C. Acetylated derivatives (CM3-AC and CM1-AC) were separated from non-acetylated chloramphenicol (CM) by ascending thin layer chromatography in chloroform/methanol (95:5) solvent. (C) Densitometry of three separate CAT assays expressed in arbitrary units of density of TNF-{alpha} CAT (CM3-AC) in crocidolite-exposed THP-1 cells expressing either an empty vector or the wild-type MKP-1 expression vector. For statistical comparisons, * denotes a comparison of vector to MKP-1 in cells exposed to asbestos (P < 0.003). (D) RAW 264.7 macrophages were transiently co-transfected with TNF-{alpha}-luc, and either an empty vector or pRKF-Flag-MKP-1 (C258S) and a Renilla luciferase plasmid. After 24 hours, cells were exposed to 10 µg/cm2 crocidolite asbestos for 6 hours. Luciferase activity, which was normalized to Renilla luciferase expression, is expressed in Real Light Units. For statistical comparisons, * denotes comparison of control (Vector) to control (MKP-1 (C258S)) (P < 0.0005), and ** denotes comparison of crocidolite (Vector) to crocidolite (MKP-1 (C258S)) (P < 0.0066).

 
To provide additional physiologic relevance of the role of MKP-1, we transiently co-transfected THP-1 monocytes with a CAT reporter plasmid driven by a full-length TNF-{alpha} promoter with either an empty vector or a wt Flag-MKP-1 expression vector. The day after the transfection, cells were exposed to crocidolite asbestos for 24 hours and then harvested. Whole cell lysates, which were normalized to protein, were prepared, and CAT assays were performed. We found that crocidolite significantly increased CAT activity in cells expressing the empty vector, but this activity was partially abrogated in cells overexpressing wt Flag-MKP-1 (Figure 5B). The CAT activity was not inhibited to control levels because the THP-1 monocytes likely oxidized a portion of the overexpressed MKP-1, as shown in Figure 4. Densitometry of three separate experiments demonstrated that overexpression of wt Flag-MKP-1 in monocytes significantly reduced TNF-{alpha} CAT activity after crocidolite stimulation (Figure 5C). These data indicate that the p38 MAP kinase is necessary for TNF-{alpha} gene expression and that overexpression of wt MKP-1, which inactivates p38 by dephosphorylation, inhibits gene expression driven by a TNF-{alpha} promoter in monocytes exposed to asbestos.

Finally, based on the lack of oxidation of MKP-1 in macrophages, we evaluated the effects of the mutant Flag-MKP-1 (C258S) expression vector on TNF-{alpha} production in macrophages. RAW 264.7 macrophages were transiently co-transfected with the TNF-{alpha} luciferase reporter plasmid and either the empty vector or the Flag-MKP-1 (C258S) expression vector. After 24 hours, the cells were exposed to crocidolite asbestos for 6 hours, and luciferase activity was determined and normalized to Renilla luciferase expression. We found that cells expressing Flag-MKP-1 (C258S) had almost a 20-fold increase in luciferase activity after exposure to asbestos, while cells expressing the empty vector were no different than controls (Figure 5D). Taken together, these data also suggest that MKP-1, through increased expression and lack of oxidation, regulates p38 MAP kinase activity and TNF-{alpha} gene expression in alveolar macrophages exposed to asbestos.


   DISCUSSION
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
References
 
We have previously shown that H2O2-mediated signaling activates the p38 MAP kinase and induces TNF-{alpha} gene expression in blood monocytes exposed to asbestos (8). This study also demonstrated that normal alveolar macrophages have limited H2O2-mediated signaling secondary to the high level of expression and activity of catalase and GPx. In this report, we ask if a phosphatase could be playing a role in this regulation in alveolar macrophages. We found that MKP-1 was highly expressed in alveolar macrophages, and the level of protein expression increased with exposure to asbestos. When MKP-1 expression or activity was inhibited or a mutant MKP-1 (C258S) was overexpressed, p38 activity was recovered in alveolar macrophages exposed to asbestos. Since the activity of MKP-1 is redox regulated, we ask if the oxidation state of MKP-1 played a role dictating the contrasting responses of these cells to asbestos exposure. We found that MKP-1 was oxidized in blood monocytes, while the vast majority of the MKP-1 expressed in alveolar macrophages was in the reduced form. We also found that overexpression of wt MKP-1 in monocytes reduced and overexpression of the mutant MKP-1 (C258S) in macrophages increased TNF-{alpha} gene expression. These data suggest that MKP-1, through increased expression and lack of oxidation, regulates p38 MAP kinase activity and TNF-{alpha} gene expression in alveolar macrophages exposed to asbestos.

Multiple studies have indicated that ROS, such as H2O2, can activate various signaling pathways, including MAP kinases (4, 8, 11, 14, 40, 41). Although these studies link H2O2 to MAP kinase activation and MAP kinase–regulated gene expression, the mechanism by which H2O2 activates the p38 MAP kinase has not been clearly determined. Only one study by Kamata and coworkers demonstrated that TNF-{alpha}–induced ROS caused oxidation and inhibition of phosphatases that resulted in sustained JNK activation (33). Thus, since the modulation of MAP kinase activity by MKPs is an important mechanism of regulation, one conceivable mechanism of p38 MAP kinase activation in monocytes exposed to asbestos could be through the inactivation of MKPs. The MKPs are a subgroup of the PTPs, which contain a highly conserved cysteine that is essential for catalytic activity. In addition to being necessary for phosphatase activity, the conserved cysteine is also sensitive to oxidation secondary to its low pKa (30–32, 42). Studies indicate that micromolar concentrations of H2O2 can oxidize the catalytic cysteine, and this oxidation of the catalytic cysteine results in inactivation of the phosphatase (29, 31, 33, 43). Furthermore, phosphatase inactivation is often associated with sustained MAP kinase activation. Our data is the first to demonstrate that the differential expression and oxidation of MKP-1 in blood monocytes compared with alveolar macrophages modulates p38 MAP kinase activation.

The formation of sulfenic, sulfinic, or sulfonic acids, which represent the addition of one (-SOH), two (-SO2H), or three (-SO3H) oxygens, respectively, results from the oxidation of a catalytic cysteine by H2O2 (29, 31). The sulfenic acid protein is unstable and highly reactive and can be reduced to form a disulfide, which, by further reduction, can be converted back to the original cysteine residue. The sulfinic and sulfonic acid proteins, however, cannot be reduced and are, thus, end products of oxidation (29, 31). Although we did not determine the products of MKP-1 oxidation, our novel data are the first to clearly indicate that essentially all of MKP-1 is oxidized in blood monocytes, and that the addition of reducing agents did not significantly alter the electrophoretic mobility shift of the oxidized MKP-1 (data not shown). This suggests that the oxidation of MKP-1 in blood monocytes produces irreversible modifications; that is, the oxidation results in the formation of sulfinic and/or sulfonic acids. In contrast, the MKP-1 in alveolar macrophages was reduced, indicating that it was an active dual-specificity phosphatase. More importantly, p38 phosphorylation was recovered in macrophages with overexpression of a MKP-1 in which the catalytic cysteine, Cys-258, was converted to a serine residue. Taken together, these novel data demonstrate that MKP-1 is oxidized in blood monocytes exposed to asbestos, while MKP-1 in alveolar macrophages remains in the reduced, or active, form. These data also suggest that the differential oxidation of MKP-1 plays a significant role in regulating signaling in response to asbestos.

The dual phosphorylation of Thr-180 and Tyr-182 is required for p38 MAP kinase activation (44), and dephosphorylation of either residue is sufficient for inactivation. MKP-1 is a dual-specificity phosphatase that can dephosphorylate ERK, JNK, and p38, but several studies have demonstrated that the p38 MAP kinase is the preferred substrate for MKP-1 (19–23, 37, 45). In addition, some recent studies have demonstrated that MKP-1 is essential for regulation of proinflammatory cytokine production in vivo in a murine model of sepsis (46–48). Thus, our data in alveolar macrophages corroborates these in vivo studies. These previous studies and our data do not, however, preclude the involvement of other phosphatases. In fact, studies have shown that three protein tyrosine phosphatases, PTP2, PTP3, and HePTP, directly dephosphorylate the tyrosine residue in the activation loop of p38 MAP kinase (49, 50). We chose to focus on MKP-1, however, because our data reveal a striking difference in MKP-1 protein expression when comparing blood monocytes to alveolar macrophages. In addition, our data clearly demonstrate that MKP-1 plays a major role in regulating p38 activity in alveolar macrophages due to the fact that inhibition of expression, removal by immunoprecipitation, or overexpression of a catalytic mutant of MKP-1 activates the p38 MAP kinase after exposure to asbestos.

We and others have shown that the p38 MAP kinase is necessary for cytokine gene expression in monocytes and macrophages (8, 51–55). Several studies have also demonstrated that inhibition of phosphatases, including MKP-1, prolongs MAP kinase activation (33, 56, 57). Most of the studies investigating the effect of increased MKP-1 expression demonstrate negative regulation of proinflammatory cytokine production and apoptosis (23, 26, 33, 56, 58, 59). One study indicated that increased MKP-1 expression resulted in increase of TNF-{alpha} and IL-1beta via enhanced Toll-like receptor 2 expression (60). Of these studies, only that of Kamata and colleagues investigated the effect of MKP oxidation on signaling. Our results clearly indicate that MKP-1 regulates p38 MAP kinase activation and TNF-{alpha} gene expression in alveolar macrophages and that the oxidation of MKP-1 inhibits MKP-1 activity in monocytes, which produce TNF-{alpha} after exposure to asbestos. These findings are also supported by the fact that overexpression of mutant MKP-1 (C258) significantly increased TNF-{alpha} gene expression in macrophages. Our study also corroborates previous studies showing that alveolar macrophages from patients with asbestosis function differently than macrophages obtained from the lungs of normal subjects, and that these cells from patients with asbestosis resemble monocytes, which produce cytokines when exposed to asbestos. Furthermore, these data are the first to provide a mechanistic explanation of why blood monocytes, rather than alveolar macrophages, produce TNF-{alpha} when exposed to asbestos.


   Acknowledgments
 
The authors thank Drs. Karin, Maniatis, and Kuprash for providing their respective plasmids; and Kevin Orcutt for technical assistance.


   Footnotes
 
This work was supported by a Veterans Affairs Merit Review Grant and an American Lung Association Career Investigator Award (both to A.B.C.).

Originally Published in Press as DOI: 10.1165/rcmb.2006-0268OC on May 16, 2007

Conflict of Interest Statement: None of the authors has a financial relationship with a commercial entity that has an interest in the subject of this manuscript.

Received in original form July 24, 2006

Accepted in final form April 9, 2007


   References
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 

  1. Hance AJ, Douches S, Winchester RJ, Ferrans VJ, Crystal RG. Characterization of mononuclear phagocyte subpopulations in the human lung by using monoclonal antibodies: changes in alveolar macrophage phenotype associated with pulmonary sarcoidosis. J Immunol 1985;134:284–292.[Abstract]
  2. Schwartz DA, Galvin JR, Frees KL, Dayton CS, Burmeister LF, Merchant JA, Hunninghake GW. Clinical relevance of cellular mediators of inflammation in workers exposed to asbestos. Am Rev Respir Dis 1993;148:68–74.[Medline]
  3. Zhang Y, Lee TC, Guillemin B, Yu MC, Rom WN. Enhanced IL-1 beta and tumor necrosis factor-alpha release and messenger RNA expression in macrophages from idiopathic pulmonary fibrosis or after asbestos exposure. J Immunol 1993;150:4188–4196.[Abstract]
  4. Irani K, Xia Y, Zweier JL, Sollott SJ, Der CJ, Fearon ER, Sundaresan M, Finkel T, Goldschmidt-Clermont PJ. Mitogenic signaling mediated by oxidants in Ras-transformed fibroblasts. Science 1997;275:1649–1652.[Abstract/Free Full Text]
  5. Lander HM, Milbank AJ, Tauras JM, Hajjar DP, Hempstead BL, Schwartz GD, Kraemer RT, Mirza UA, Chait BT, Burk SC, et al. Redox regulation of cell signalling. Nature 1996;381:380–381.[CrossRef][Medline]
  6. Sundaresan M, Yu ZX, Ferrans VJ, Irani K, Finkel T. Requirement for generation of H2O2 for platelet-derived growth factor signal transduction. Science 1995;270:296–299.[Abstract/Free Full Text]
  7. Reth M. Hydrogen peroxide as second messenger in lymphocyte activation. Nat Immunol 2002;3:1129–1134.[CrossRef][Medline]
  8. Carter AB, Tephly LA, Venkataraman S, Oberley LW, Zhang Y, Buettner GR, Spitz DR, Hunninghake GW. High levels of catalase and glutathione peroxidase activity dampen H2O2 signaling in human alveolar macrophages. Am J Respir Cell Mol Biol 2004;31:43–53.[Abstract/Free Full Text]
  9. Jimenez LA, Zanella C, Fung H, Janssen YM, Vacek P, Charland C, Goldberg J, Mossman BT. Role of extracellular signal-regulated protein kinases in apoptosis by asbestos and H2O2. Am J Physiol 1997;273:L1029–L1035.[Medline]
  10. Buder-Hoffmann S, Palmer C, Vacek P, Taatjes D, Mossman B. Different accumulation of activated extracellular signal-regulated kinases (ERK 1/2) and role in cell-cycle alterations by epidermal growth factor, hydrogen peroxide, or asbestos in pulmonary epithelial cells. Am J Respir Cell Mol Biol 2001;24:405–413.[Abstract/Free Full Text]
  11. Guyton KZ, Liu Y, Gorospe M, Xu Q, Holbrook NJ. Activation of mitogen-activated protein kinase by H2O2: role in cell survival following oxidant injury. J Biol Chem 1996;271:4138–4142.[Abstract/Free Full Text]
  12. Aikawa R, Komuro I, Yamazaki T, Zou Y, Kudoh S, Tanaka M, Shiojima I, Hiroi Y, Yazaki Y. Oxidative stress activates extracellular signal-regulated kinases through Src and Ras in cultured cardiac myocytes of neonatal rats. J Clin Invest 1997;100:1813–1821.[Medline]
  13. Zhang P, Wang YZ, Kagan E, Bonner JC. Peroxynitrite targets the epidermal growth factor receptor, Raf-1, and MEK independently to activate MAPK. J Biol Chem 2000;275:22479–22486.[Abstract/Free Full Text]
  14. Benhar M, Dalyot I, Engelberg D, Levitzki A. Enhanced ROS production in oncogenically transformed cells potentiates c-Jun N-terminal kinase and p38 mitogen-activated protein kinase activation and sensitization to genotoxic stress. Mol Cell Biol 2001;21:6913–6926.[Abstract/Free Full Text]
  15. Camps M, Nichols A, Arkinstall S. Dual specificity phosphatases: a gene family for control of MAP kinase function. FASEB J 2000;14:6–16.[Abstract/Free Full Text]
  16. Keyse SM. Protein phosphatases and the regulation of mitogen-activated protein kinase signalling. Curr Opin Cell Biol 2000;12:186–192.[CrossRef][Medline]
  17. Metzler B, Hu Y, Sturm G, Wick G, Xu Q. Induction of mitogen-activated protein kinase phosphatase-1 by arachidonic acid in vascular smooth muscle cells. J Biol Chem 1998;273:33320–33326.[Abstract/Free Full Text]
  18. Valledor AF, Xaus J, Comalada M, Soler C, Celada A. Protein kinase C epsilon is required for the induction of mitogen-activated protein kinase phosphatase-1 in lipopolysaccharide-stimulated macrophages. J Immunol 2000;164:29–37.[Abstract/Free Full Text]
  19. Chu Y, Solski PA, Khosravi-Far R, Der CJ, Kelly K. The mitogen-activated protein kinase phosphatases PAC1, MKP-1, and MKP-2 have unique substrate specificities and reduced activity in vivo toward the ERK2 sevenmaker mutation. J Biol Chem 1996;271:6497–6501.[Abstract/Free Full Text]
  20. Franklin CC, Kraft AS. Conditional expression of the mitogen-activated protein kinase (MAPK) phosphatase MKP-1 preferentially inhibits p38 MAPK and stress-activated protein kinase in U937 cells. J Biol Chem 1997;272:16917–16923.[Abstract/Free Full Text]
  21. Keyse SM, Emslie EA. Oxidative stress and heat shock induce a human gene encoding a protein-tyrosine phosphatase. Nature 1992;359:644–647.[CrossRef][Medline]
  22. Kwak SP, Dixon JE. Multiple dual specificity protein tyrosine phosphatases are expressed and regulated differentially in liver cell lines. J Biol Chem 1995;270:1156–1160.[Abstract/Free Full Text]
  23. Wu JJ, Bennett AM. Essential role for mitogen-activated protein (MAP) kinase phosphatase-1 in stress-responsive MAP kinase and cell survival signaling. J Biol Chem 2005;280:16461–16466.[Abstract/Free Full Text]
  24. Valledor AF, Xaus J, Marques L, Celada A. Macrophage colony-stimulating factor induces the expression of mitogen-activated protein kinase phosphatase-1 through a protein kinase C-dependent pathway. J Immunol 1999;163:2452–2462.[Abstract/Free Full Text]
  25. Palm-Leis A, Singh US, Herbelin BS, Olsovsky GD, Baker KM, Pan J. Mitogen-activated protein kinases and mitogen-activated protein kinase phosphatases mediate the inhibitory effects of all-trans retinoic acid on the hypertrophic growth of cardiomyocytes. J Biol Chem 2004;279:54905–54917.[Abstract/Free Full Text]
  26. Seta KA, Kim R, Kim HW, Millhorn DE, Beitner-Johnson D. Hypoxia-induced regulation of MAPK phosphatase-1 as identified by subtractive suppression hybridization and cDNA microarray analysis. J Biol Chem 2001;276:44405–44412.[Abstract/Free Full Text]
  27. Lim HW, New L, Han J, Molkentin JD. Calcineurin enhances MAPK phosphatase-1 expression and p38 MAPK inactivation in cardiac myocytes. J Biol Chem 2001;276:15913–15919.[Abstract/Free Full Text]
  28. Ryser S, Tortola S, van Haasteren G, Muda M, Li S, Schlegel W. MAP kinase phosphatase-1 gene transcription in rat neuroendocrine cells is modulated by a calcium-sensitive block to elongation in the first exon. J Biol Chem 2001;276:33319–33327.[Abstract/Free Full Text]
  29. Claiborne A, Yeh JI, Mallett TC, Luba J, Crane EJ III, Charrier V, Parsonage D. Protein-sulfenic acids: diverse roles for an unlikely player in enzyme catalysis and redox regulation. Biochemistry 1999;38:15407–15416.[CrossRef][Medline]
  30. Denu JM, Dixon JE. A catalytic mechanism for the dual-specific phosphatases. Proc Natl Acad Sci USA 1995;92:5910–5914.[Abstract/Free Full Text]
  31. Denu JM, Tanner KG. Specific and reversible inactivation of protein tyrosine phosphatases by hydrogen peroxide: evidence for a sulfenic acid intermediate and implications for redox regulation. Biochemistry 1998;37:5633–5642.[CrossRef][Medline]
  32. van Montfort RL, Congreve M, Tisi D, Carr R, Jhoti H. Oxidation state of the active-site cysteine in protein tyrosine phosphatase 1B. Nature 2003;423:773–777.[CrossRef][Medline]
  33. Kamata H, Honda S, Maeda S, Chang L, Hirata H, Karin M. Reactive oxygen species promote TNFalpha-induced death and sustained JNK activation by inhibiting MAP kinase phosphatases. Cell 2005;120:649–661.[CrossRef][Medline]
  34. Lee SR, Kwon KS, Kim SR, Rhee SG. Reversible inactivation of protein-tyrosine phosphatase 1B in A431 cells stimulated with epidermal growth factor. J Biol Chem 1998;273:15366–15372.[Abstract/Free Full Text]
  35. Goldfeld AE, Doyle C, Maniatis T. Human tumor necrosis factor alpha gene regulation by virus and lipopolysaccharide. Proc Natl Acad Sci USA 1990;87:9769–9773.[Abstract/Free Full Text]
  36. Kuprash DV, Udalova IA, Turetskaya RL, Kwiatkowski D, Rice NR, Nedospasov SA. Similarities and differences between human and murine TNF promoters in their response to lipopolysaccharide. J Immunol 1999;162:4045–4052.[Abstract/Free Full Text]
  37. Charles CH, Sun H, Lau LF, Tonks NK. The growth factor-inducible immediate-early gene 3CH134 encodes a protein-tyrosine-phosphatase. Proc Natl Acad Sci USA 1993;90:5292–5296.[Abstract/Free Full Text]
  38. Goldsmith CA, Imrich A, Danaee H, Ning YY, Kobzik L. Analysis of air pollution particulate-mediated oxidant stress in alveolar macrophages. J Toxicol Environ Health A 1998;54:529–545.[CrossRef][Medline]
  39. Chin BY, Trush MA, Choi AM, Risby TH. Transcriptional regulation of the HO-1 gene in cultured macrophages exposed to model airborne particulate matter. Am J Physiol Lung Cell Mol Physiol 2003;284:L473–L480.[Abstract/Free Full Text]
  40. Ranganathan AC, Nelson KK, Rodriguez AM, Kim KH, Tower GB, Rutter JL, Brinckerhoff CE, Huang TT, Epstein CJ, Jeffrey JJ, et al. Manganese superoxide dismutase signals matrix metalloproteinase expression via H2O2-dependent ERK1/2 activation. J Biol Chem 2001;276:14264–14270.[Abstract/Free Full Text]
  41. Ushio-Fukai M, Alexander RW, Akers M, Griendling KK. p38 Mitogen-activated protein kinase is a critical component of the redox-sensitive signaling pathways activated by angiotensin II. Role in vascular smooth muscle cell hypertrophy. J Biol Chem 1998;273:15022–15029.[Abstract/Free Full Text]
  42. Salmeen A, Andersen JN, Myers MP, Meng TC, Hinks JA, Tonks NK, Barford D. Redox regulation of protein tyrosine phosphatase 1B involves a sulphenyl-amide intermediate. Nature 2003;423:769–773.[CrossRef][Medline]
  43. Meng TC, Fukada T, Tonks NK. Reversible oxidation and inactivation of protein tyrosine phosphatases in vivo. Mol Cell 2002;9:387–399.[CrossRef][Medline]
  44. Raingeaud J, Gupta S, Rogers JS, Dickens M, Han J, Ulevitch RJ, Davis RJ. Pro-inflammatory cytokines and environmental stress cause p38 mitogen- activated protein kinase activation by dual phosphorylation on tyrosine and threonine. J Biol Chem 1995;270:7420–7426.[Abstract/Free Full Text]
  45. Charles CH, Abler AS, Lau LF. cDNA sequence of a growth factor-inducible immediate early gene and characterization of its encoded protein. Oncogene 1992;7:187–190.[Medline]
  46. Chi H, Barry SP, Roth RJ, Wu JJ, Jones EA, Bennett AM, Flavell RA. Dynamic regulation of pro- and anti-inflammatory cytokines by MAPK phosphatase 1 (MKP-1) in innate immune responses. Proc Natl Acad Sci USA 2006;103:2274–2279.[Abstract/Free Full Text]
  47. Hammer M, Mages J, Dietrich H, Servatius A, Howells N, Cato AC, Lang R. Dual specificity phosphatase 1 (DUSP1) regulates a subset of LPS-induced genes and protects mice from lethal endotoxin shock. J Exp Med 2006;203:15–20.[Abstract/Free Full Text]
  48. Zhao Q, Wang X, Nelin LD, Yao Y, Matta R, Manson ME, Baliga RS, Meng X, Smith CV, Bauer JA, et al. MAP kinase phosphatase 1 controls innate immune responses and suppresses endotoxic shock. J Exp Med 2006;203:131–140.[Abstract/Free Full Text]
  49. Wurgler-Murphy SM, Maeda T, Witten EA, Saito H. Regulation of the Saccharomyces cerevisiae HOG1 mitogen-activated protein kinase by the PTP2 and PTP3 protein tyrosine phosphatases. Mol Cell Biol 1997;17:1289–1297.[Abstract]
  50. Lee K, Esselman WJ. Inhibition of PTPs by H2O2 regulates the activation of distinct MAPK pathways. Free Radic Biol Med 2002;33:1121–1132.[CrossRef][Medline]
  51. Carter AB, Hunninghake GW. A constitutive active MEK --->ERK pathway negatively regulates NF-kappa B-dependent gene expression by modulating TATA-binding protein phosphorylation. J Biol Chem 2000;275:27858–27864.[Abstract/Free Full Text]
  52. Carter AB, Knudtson KL, Monick MM, Hunninghake GW. The p38 mitogen-activated protein kinase is required for NF-kappaB- dependent gene expression. The role of TATA-binding protein (TBP). J Biol Chem 1999;274:30858–30863.[Abstract/Free Full Text]
  53. Lee JC, Laydon JT, McDonnell PC, Gallagher TF, Kumar S, Green D, McNulty D, Blumenthal MJ, Heys JR, Landvatter SW, et al. A protein kinase involved in the regulation of inflammatory cytokine biosynthesis. Nature 1994;372:739–746.[CrossRef][Medline]
  54. Lee JC, Young PR. Role of CSB/p38/RK stress response kinase in LPS and cytokine signaling mechanisms. J Leukoc Biol 1996;59:152–157.[Abstract]
  55. Monick MM, Carter AB, Gudmundsson G, Mallampalli R, Powers LS, Hunninghake GW. A phosphatidylcholine-specific phospholipase C regulates activation of p42/44 mitogen-activated protein kinases in lipopolysaccharide- stimulated human alveolar macrophages. J Immunol 1999;162:3005–3012.[Abstract/Free Full Text]
  56. Guo YL, Kang B, Williamson JR. Inhibition of the expression of mitogen-activated protein phosphatase-1 potentiates apoptosis induced by tumor necrosis factor-alpha in rat mesangial cells. J Biol Chem 1998;273:10362–10366.[Abstract/Free Full Text]
  57. Wadgaonkar R, Pierce JW, Somnay K, Damico RL, Crow MT, Collins T, Garcia JG. Regulation of c-Jun N-terminal kinase and p38 kinase pathways in endothelial cells. Am J Respir Cell Mol Biol 2004;31:423–431.[Abstract/Free Full Text]
  58. Shepherd EG, Zhao Q, Welty SE, Hansen TN, Smith CV, Liu Y. The function of mitogen-activated protein kinase phosphatase-1 in peptidoglycan-stimulated macrophages. J Biol Chem 2004;279:54023–54031.[Abstract/Free Full Text]
  59. Laderoute KR, Mendonca HL, Calaoagan JM, Knapp AM, Giaccia AJ, Stork PJ. Mitogen-activated protein kinase phosphatase-1 (MKP-1) expression is induced by low oxygen conditions found in solid tumor microenvironments: a candidate MKP for the inactivation of hypoxia-inducible stress-activated protein kinase/c-Jun N-terminal protein kinase activity. J Biol Chem 1999;274:12890–12897.[Abstract/Free Full Text]
  60. Imasato A, Desbois-Mouthon C, Han J, Kai H, Cato AC, Akira S, Li JD. Inhibition of p38 MAPK by glucocorticoids via induction of MAPK phosphatase-1 enhances nontypeable Haemophilus influenzae-induced expression of toll-like receptor 2. J Biol Chem 2002;277:47444–47450.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Respir. Cell Mol. Bio.Home page
L. A. Tephly and A. B. Carter
Asbestos-Induced MKP-3 Expression Augments TNF-{alpha} Gene Expression in Human Monocytes
Am. J. Respir. Cell Mol. Biol., July 1, 2008; 39(1): 113 - 123.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2006-0268OCv1
37/3/366    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tephly, L. A.
Right arrow Articles by Carter, A. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tephly, L. A.
Right arrow Articles by Carter, A. B.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2007 American Thoracic Society.