help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Published ahead of print on September 13, 2007, doi:10.1165/rcmb.2007-0232OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2007-0232OCv1
38/2/192    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morin, C.
Right arrow Articles by Rousseau, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morin, C.
Right arrow Articles by Rousseau, E.
American Journal of Respiratory Cell and Molecular Biology. Vol. 38, pp. 192-201, 2008
© 2008 American Thoracic Society
DOI: 10.1165/rcmb.2007-0232OC

EET Displays Anti-Inflammatory Effects in TNF-{alpha}–Stimulated Human Bronchi

Putative Role of CPI-17

Caroline Morin1, Marco Sirois2, Vincent Echave2, Marcio M. Gomes3 and Eric Rousseau1

1 Le Bilarium, Department of Physiology and Biophysics, 2 Service of Thoracic Surgery, and 3 Department of Pathology, Faculty of Medicine and Health Sciences, Université de Sherbrooke, Sherbrooke, Quebec, Canada

Correspondence and requests for reprints should be addressed to Eric Rousseau, Ph.D., Le Bilarium, Department of Physiology and Biophysics, Faculty of Medicine and Health Sciences, Université de Sherbrooke, 3001, 12th Avenue North, Sherbrooke, PQ, J1H 5N4 Canada. E-mail: Eric.Rousseau{at}USherbrooke.ca


   Abstract
Top
 Abstract
CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
The aim of the present study was to investigate the anti-inflammatory effects of 14,15-epoxyeicosatrienoic acid (EET) on reactivity and Ca2+ sensitivity in TNF-{alpha}–stimulated human bronchi. Tension measurements performed on either control, TNF-{alpha}–, or TNF-{alpha} + EET–pretreated bronchi revealed that 100 nM 14,15-EET pretreatments significantly reduced the reactivity of TNF-{alpha}–pretreated tissues to contractile agonists. EET also normalized the relaxing response to isoproterenol in TNF-{alpha}–treated bronchi. Pretreatment with 100 nM 14,15-EET prevented TNF-{alpha}–induced I{kappa}B{alpha} degradation, as demonstrated by an increase in I{kappa}B{alpha} protein levels on Western blot analysis. The anti-inflammatory properties of EET were mediated by the inhibition of I{kappa}B{alpha} degradation, suggesting a lower activation of NF-{kappa}B. The Ca2+ sensitivity of TNF-{alpha}–stimulated bronchi was also evaluated on β-escin–permeabilized preparations. Observed mean responses demonstrated that EET pretreatments abolished Ca2+ hypersensitivity developed by TNF-{alpha}–stimulated bronchial explants. Moreover, 14,15-EET significantly reduced PDBu-induced Ca2+ sensitivity in TNF-{alpha}–stimulated bronchi. Western blot and RT-PCR analyses revealed that CPI-17 protein and transcript levels were increased in TNF-{alpha}–treated bronchi, as opposed to being decreased in the presence of 14,15-EET. This eicosanoid also reduced U-46619–induced Ca2+ sensitivity, which is related to the activation of Rho-kinase pathway. These results were also correlated with an increase in protein staining and transcription level of p116Rip, a RhoA inhibitory-binding protein. Altogether, these data demonstrate that 14,15-EET is a potent modulator of the hyperreactivity triggered by TNF-{alpha} in human airway smooth muscle cells.

Key Words: epoxyeicosatrienoic acid • TNF-{alpha} • human bronchial smooth muscle • CPI-17 • NF-{kappa}B



   CLINICAL RELEVANCE
Top
 Abstract
 CLINICAL RELEVANCE
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
The current research and the results obtained may be highly relevant for human diseases, such as asthma and chronic obstructive pulmonary disease.

 
Epoxyeicosatrienoic acids (EETs) are cytochrome P-450 epoxygenase (CYP-450) metabolites of arachidonic acid (AA) (1, 2). Epoxygenase enzymes are present in lungs of many species, including humans (2, 3), and produce four EET epoxy-regioisomers: 5,6-, 8,9-, 11,12-, and 14,15-EET (2). One of the recently explored functions of these enzymes is their ability to promote endothelial cell growth (4–8). 14,15-EET is the most abundant regioisomer in the lung (3, 7), while all EET regioisomers have been described as angiogenic compounds (9). EETs are known for their ability to modulate vascular (2, 10, 11) and airway smooth muscle (ASM) tone (12–14). In guinea pig and human bronchi, exogenous addition of EETs has been shown to activate BKCa channels, which in turn hyperpolarizes and relaxes ASM cells (12, 14). Recently, our group reported that 14,15-EET decreases the Ca2+-sensitivity of ASM cells by reducing the level of phosphorylated CPI-17 protein (13, 14). This phosphorylation is usually ascribed to a PKC-dependent process (15). The mode of action of eicosanoids was further highlighted by the observations that EET regioisomers display anti-inflammatory effects in the vascular bed, most likely through an endothelium-dependent process, and mediated by the inhibition of cytokine-induced nuclear factor-{kappa}B (NF-{kappa}B) (16). 11,12-EET also produces a potent effect in bovine aortic endothelial cells by inhibiting IKK-mediated phosphorylation of I{kappa}B{alpha}, which maintains NF-{kappa}B in an inactive state (11). Despite the fact that EET-compounds can be stored into membrane phospholipids upon esterification of lyso-phospholipids in sn-2 position, their half-life is mainly determined by the enzymatic activity of soluble epoxide hydrolase (sEH), which facilitates hydroxylation of the epoxy group, thereby yielding inactive DHET compounds (17). Thus, the inhibition of sEH incurs an accumulation of EETs and a longer life span after they are formed, presumably enhancing their beneficial autocrine and paracrine effects (17). Furthermore, it was reported that AUDA, a sEH inhibitor, enhances the anti-inflammatory effects of EET in endothelial cells by increasing EET-induced peroxisome proliferators–activated receptor gamma (PPAR{gamma}) transcriptional activity (18).

The actomyosin system plays a fundamental role in the regulation of cell motility, including cell contractility, migration, division, and shape changes (15). Contraction of ASM occurs via two related mechanisms: (1) a rise in cytosolic calcium concentration ([Ca2+]i), which results in the formation of calcium/calmodulin complexes and activation of the myosin light chain kinase (MLCK). The activated MLCK phosphorylates the 20-kD myosin light chain (MLC) (15), which in turn results in ASM cell contraction. (2) A second Ca2+-independent mechanism, which requires the activation of Rho-kinase, as well as PKC-dependent phosphorylation of the 17-kD myosin phosphatase inhibitor protein (called CPI-17) to maintain tone (19). This pathway regulates both myosin phosphorylation and dephosphorylation processes. The Ca2+ sensitization mechanism occurs during agonist-induced activation of the Rho-kinase or PKC/CPI-17 pathway, and leads to the inhibition of myosin light chain phosphatase (MLCP) (20). Rho-kinase inhibits MLCP activity by phosphorylating the myosin-binding subunit of MLCP. MLCP consists of three subunits: a myosin phosphatase targeting subunit (MYPT1), a small subunit of 20 kD and a catalytic subunit of the type 1 protein serine/threonine phosphatase family (21–23). MYPT1 has been shown to be phosphorylated by Rho kinase, resulting in a decrease in MLCP activity in vitro (24). However, a recent report has also shown the interaction of MYPT1 with a second partner, p116Rip, which conversely activates MLCP (25). Furthermore, it was found that p116Rip has a RhoGAP-like activity, thus inactivating RhoA activity (26). Hence, p116Rip is an important regulatory component that controls the RhoA signaling pathway, thus regulating both MLCP activity and myosin phosphorylation in smooth muscle cells (24). Alternatively, CPI-17 phosphorylation also results in an inhibition of MLCP activity, which in turn maintains steady-state tension in ASM (20, 27). By contrast, CPI-17 de-phosphorylation facilitates relaxation.

In human lung, TNF-{alpha} has been shown to be involved in the activation of inflammatory processes, which lead to asthma and other inflammatory diseases such as chronic obstructive pulmonary disease (COPD) (28, 29). However, the precise biochemical mechanisms alleviating this pathophysiologic state are still poorly understood. Herein, TNF-{alpha} pretreatments were used to induce a hyperresponsiveness, which include an overreactivity and Ca2+ hypersensitivity, in a model of human bronchi, as previously demonstrated by other studies in mouse and rat bronchi (30–32). The objectives of the present study were: (1) to investigate the anti-inflammatory effects of 14,15-EET on reactivity of TNF-{alpha}–pretreated human bronchi at the tissue level; (2) to determine the effect of the eicosanoid on Ca2+ sensitivity; and (3) to assess the putative modulation of specific proteins such as CPI-17 and p116Rip, both at the cellular and molecular levels. Herein we report the first evidence that 14,15-EET displays an anti-inflammatory effect on TNF-{alpha}–treated human bronchi and that this effect is related to the inactivation of NF-{kappa}B. We also demonstrate that 14,15-EET decreases the Ca2+-hypersensitivity of myofilaments in these preparations by decreasing the phosphorylation and expression level of CPI-17 with a concomitant increase in the expression of p116Rip, two newly described regulatory proteins.


   MATERIALS AND METHODS
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 References
 
Isolation and Organ Culture of Human Bronchi
The study was approved by our institution's Ethics Committee (Protocol number CRC 05–088). Human lung tissues were obtained from 19 patients undergoing surgery for lung carcinoma. After lobectomy and transport in sterile physiologic saline solution, lung samples, distant from the malignant lesion, were dissected by the pathologist. The absence of tumoral infiltration was retrospectively established in all bronchi by pathologic analysis. Tissue samples were immediately placed in Krebs solution containing (in mM): 118 NaCl, 4.7 KCl, 2.5 CaCl2, 1.2 KH2PO4, 1.2 MgSO4, 25 NaHCO3, and 11.1 dextrose; pH 7.4, previously bubbled with 95% O2 and 5% CO2 at 22°C and then immediately transported to a level 2-culture room. After removal of connective tissues and adhering parenchyma, paired rings of similar weight and length (inner diameter of 0.5–0.8 mm) were micro-dissected from the same bronchial segment. Bronchial rings were placed in individual wells of 24-well culture plates containing Dulbecco's modified Eagle's medium (DMEM)-F12 culture medium (1 ml/well) supplemented with 0.3% penicillin (100 IU/ml) and streptomycin (0.1 mg/ml). Culture plates were placed in a humidified incubator at 37°C under 5% CO2 (14). Explants were untreated (control) or treated (every 12 h for 48 h) with either 10 ng/ml TNF-{alpha}, or 10 ng/ml TNF-{alpha} combined with 100 nM 14,15-EET (every 12 h), since degradation by the soluble epoxy hydrolase sEH might occur or with 100 nM 14,15-EET alone (every 12 h), before pharmacologic challenge. Complementary experiments were performed after pretreatment with 10 ng/ml TNF-{alpha} combined with 100 nM 14,15-EET, and 1 µM AUDA, the sEH inhibitors.

Isometric Tension Measurements
The mechanical effects induced by specific agonists and eicosanoids were measured as previously described (13, 14). Bronchial rings were mounted in isolated organ baths, containing 6 ml of Krebs solution at 37°C, bubbled continually with the 95% O2/5% CO2 mixture and to which an initial load of 0.6 g was applied. Tissues were allowed to equilibrate for 1 hour in Krebs solution and washed out every 15 minutes. Passive and active tensions were assessed using transducer systems (Radnoti Glass Tech., Monrovia, CA) coupled to Polyview software (Grass-Astro-Med Inc, West Warwick, RI) for facilitating data acquisition and analysis.

Permeabilization with β-Escin
The measurement of resulting induced myofilament Ca2+ sensitivity was performed as previously reported (13, 14). Bronchial rings were mounted in organ baths and incubated in low free Ca2+ relaxing solution containing (in mM): 87 KCl, 5.1 MgCl2, 5.2 NaATP, 10 creatine phosphate, 2 EGTA, and 10 PIPES, brought to pH 7.2 with KOH, at 22°C, followed by treatment with 50 µM β-escin in the relaxing solution for 35 minutes at 22°C. Ca2+ stores were depleted by addition of 10 µM A23187. Tension developed by permeabilized bronchial rings was measured in activating solutions, containing 10 mM EGTA and specified concentrations of CaCl2 to yield the desired free-Ca2+ concentration, pCa = –log [Ca2+] (14).

SDS-PAGE and Western Blot Analysis
Human bronchi were dissected, weighed, and promptly transferred in a buffer containing 0.3 M sucrose, 20 mM K-PIPES, 4 mM EGTA, and a cocktail of protease inhibitors (Protease-inhibitor pellets from Roche Diagnostics, Indianapolis, IN). Tissues were then homogenized on ice, frozen in liquid nitrogen, and stored at –80°C. For SDS-PAGE, protein samples (20 µg of protein/well) from homogenate fractions were dissolved in 2% SDS and separated on 15% SDS-PAGE, using a 3% stacking gel. Gels were cast into a mini-protean III dual cell (Bio-Rad, Mississauga, ON, Canada). Western blots using specific antibodies against CPI-17, its phosphorylated form (Anti P-CPI-17), p116Rip, and β-actin proteins were performed on homogenate fractions (14). The separated proteins from SDS-PAGE were electrophoretically transferred at 70 V onto nitrocellulose membranes (Bio-Rad) for 2 hours at 4°C. Transferred membranes were blocked with Tris-Buffered Solution containing 0.1% Tween 20 (TBS-T) + 5% nonfat diet milk overnight and then incubated for 180 minutes with 1 µg/ml of the selected specific antibody in TBS-T. After three washings, membranes were incubated for 1 hour at 23°C with peroxidase-conjugated donkey anti-rabbit IgG1 antiserum (Amersham, Baie d'Urfe, PQ, Canada) and revealed by Enhanced Chemiluminescence (Roche, Mississauga, ON, Canada). Blot immunostainings were digitized and analyzed with Lab-Image software 2.7–2 (Kapelan, Halle, Germany).

RT-PCR and Specific Fragment Detections
Human bronchi were dissected, weighed, and cultured during 48 hours. Total RNA was extracted from cultured tissue using the Qiagen RNeasy Mini Kit (Qiagen, Mississauga, ON, Canada), according to the manufacturer's instructions. A total of 400 ng total RNA was reverse-transcribed into cDNA with a Qiagen Omniscript RT kit (Qiagen Canada) according to the manufacturer's instructions. Primers used for detection of human transcripts were of the following sequences. CPI-17: forward CTGAGCAAGCTGCAGTCTCCA, reverse CTTATACACAAGCAAGCTGGGCGG; p116Rip: forward GAGGAGAGCGCCATGAGTAG, reverse CATCGTAACATGCGGACAAG; and GAPDH: forward GTGGTCTCCTCTGACTTCAAC, reverse GCTGTAGCCAAATTCGTTGTC, respectively. Aliquots of the reverse-transcribed cDNA were then amplified by PCR reactions (30 cycles) (33). After PCR, the samples were migrated for 75 minutes on a 1% agar gel + ethydium bromide, and images acquired under ultraviolet light.

Drugs and Chemical Reagents
14,15-EET was obtained from Cayman Chemical (Ann Arbor, MI), dissolved in 100% ethanol (EtOH) and stored as 1 mM stock solutions. PDBu was purchased from Calbiochem (VWR, Montreal, PQ, Canada). The vehicle was tested separately at the maximal concentration used in the presence of active compound. Methacholine chloride (MCh), histamine, U-46619, and Isoproterenol were purchased from Sigma (St Louis, MO). DMEM-F12 and Penicillin-Streptomycin were purchased from Gibco Invitrogen Corp. (Burlington, ON, Canada).

Data Analysis and Statistics
Results are expressed as means ± SEM; n indicates the number of experiments. Statistical analyses were performed using a Student t test or a one-way ANOVA. Differences were considered statistically significant when P < 0.05. Data curve fittings were performed using Sigma Plot 9.0 (SPSS-Science, Chicago, IL) to determine EC50 values (13, 14).


   RESULTS
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 References
 
Effects of 14,15-EET on TNF-{alpha}–Pretreated Bronchi
In a previous report, we had shown that TNF-{alpha} pretreatment (10 ng/ml) induced an overreactivity in short-term cultured human bronchi (14). Herein, the pharmaco-mechanical properties of these preparations were investigated under various experimental conditions. Human distal bronchi were cultured for 2 days in the absence or presence of 100 nM 14,15-EET and thereafter challenged with the various agonists histamine, U-46619, and isoproterenol. Figure 1A shows that the eicosanoid treatment largely reduced the pharmacologic reactivity of TNF-{alpha}–pretreated tissues to histamine. Figure 1B illustrates cumulative concentration response curves (CCRC) to U-46619, a thromboxane prostanoid (TP) receptor agonist, from control (untreated) as well as from two series of TNF-{alpha}–pre-treated bronchi. While TNF-{alpha} consistently induced an overreactivity to the thromboxane agonist, addition of 100 nM 14,15-EET in the culture medium prevented the hyperreactivity induced by TNF-{alpha} (Figure 1B). The EC50 value to U-46619 upon TNF-{alpha} pretreatments (0.01 µM) was shifted toward lower concentrations comparatively to the EC50 (0.03 µM) under control conditions. In the presence of 14,15-EET in the culture medium, the EC50 value (0.032 µM) was shifted toward the control value, with a significant decrease in maximum tension (Figure 1B, open squares).


Figure 1
View larger version (17K):
[in this window]
[in a new window]

  		Figure 1. 14,15-EET counters the effects of TNF-{alpha} pretreatments in human cultured bronchi in pharmacologic challenges. (A) Representative trace showing the contractile effect induced by histamine on TNF-{alpha}–pretreated bronchi in the absence (black line) or presence (gray line) of 14,15-EET. (B) Cumulative concentration response curves (CCRC) to U-46619 generated from untreated (control) and TNF{alpha}-pretreated bronchi in the absence or presence of 100 nM 14,15-EET. (C) Quantitative analysis of the relaxing responses induced by isoproterenol in control, TNF-{alpha}–pretreated and 14,15-EET + TNF-{alpha}–pretreated human bronchi. Each point represents the mean ± SEM, with n = 18 for each experimental condition. *P < 0.05.

 
The relaxing properties to isoproterenol (a β2–agonist) were also determined for control and TNF-{alpha}–treated bronchi. Figure 1C displays the CCRC to isoproterenol in control and TNF-{alpha}–treated explants. Data reveal that the relaxing responses to the β2-agonist were reduced in TNF-{alpha}–treated explants. The presence of 100 nM 14,15-EET in the culture medium counteracted the effects of TNF-{alpha} and facilitated the recovery of the normal responses to isoproterenol. Together these results show that 48-hour TNF-{alpha} treatment induces a hyperreactivity while decreasing the relaxing response to a β2-agonist in human bronchial explants. Conversely, in the presence of TNF-{alpha}, a low concentration of EET significantly reduces the reactivity and the sensitivity of human bronchial smooth muscle to contractile agonists and normalizes their relaxing responses.

14,15-EET Inhibits NF-{kappa}B–Mediated Transcription in Human Bronchi
To determine whether 14,15-EET normalizes the hyperreactivity triggered by TNF-{alpha} and whether it mediates a putative anti-inflammatory effect in TNF-{alpha}–treated human bronchi, the activation of nuclear factor {kappa}B (NF-{kappa}B) was investigated. Activation of this factor is usually reversely correlated with a reduction in I{kappa}B{alpha} due to extensive ubiquitination and proteosomal degradation of this inhibitory subunit. Western blot analysis shows that TNF-{alpha} pretreatments resulted in I{kappa}B{alpha} degradation when compared with control cultured tissues (Figure 2A, lane 2 versus lane1). This TNF-{alpha}–dependent degradation consistently resulted in a reduction of specific protein staining in the cytokine-pretreated bronchi. However, the addition of 100 nM 14,15-EET in the presence of TNF-{alpha} in the culture media, either in the absence or the presence of 1 µM AUDA (an epoxy hydrolase inhibitors), prevented this TNF-{alpha}–induced I{kappa}B{alpha} degradation (Figure 2A, lane 3). Similar staining density ratio of I{kappa}B{alpha} were observed between untreated (control) tissues and TNF-{alpha}–pretreated bronchi in presence of 14,15-EET. Quantitative analysis of immunoblot membranes was normalized as a function of total β-actin staining in the corresponding fraction. As shown in Figure 2B, pretreatment of the bronchial explants with TNF-{alpha} and 14,15-EET for 48 hours, or TNF-{alpha} + 14,15-EET + AUDA (third and fourth row, respectively), significantly increased the staining density ratio of I{kappa}B{alpha} when compared with TNF-{alpha}–stimulated bronchi. These results demonstrate that 14,15-EET counters the biochemical effects induced by TNF-{alpha}, through the inhibition of I{kappa}B{alpha} degradation, thus suggesting a lower activation of NF-{kappa}B–mediated transcription as previously described in cell culture experiments (16, 18). Furthermore, the data herein are well correlated with the results obtained from functional measurements reported above.


Figure 2
View larger version (21K):
[in this window]
[in a new window]

  		Figure 2. 14,15-EET inhibits I{kappa}B{alpha} degradation in TNF-{alpha}–pretreated bronchi. (A) Cytosolic protein fractions were stained using specific primary antibodies against I{kappa}B{alpha} and β-actin followed by a secondary peroxidase-conjugated donkey anti-rabbit IgG1 antiserum. Note the very low staining level of the I{kappa}B{alpha} band in TNF-{alpha}–treated preparations (second row), while positive staining was consistently detected in control conditions (first row), in TNF-{alpha} + 100 nM 14,15-EET (third row) and TNF-{alpha} + 14,15-EET + 1 µM AUDA–treated tissues (fourth row). (B) Quantitative analysis of various I{kappa}B{alpha}/β-actin density ratios. Staining densities in the homogenates were expressed as a function of the β-actin signal. Significant differences were observed between control versus TNF-{alpha} alone and the latter versus 14,15-EET + TNF-{alpha}–treated tissues, either in the absence or the presence of AUDA. Results are representative of five similar experiments, *P < 0.05.

 
14,15-EET Reduces TNF-{alpha}–Induced Calcium Hypersensitivity
Comparative analyses were performed on β-escin–permeabilized preparations to assess the effect of 14,15-EET on Ca2+ sensitivity of TNF-{alpha}–pretreated bronchi. Figure 3A shows superimposed recordings induced by cumulative free [Ca2+] increments on TNF-{alpha}–pretreated bronchi (48 h), in either the absence or presence of 100 nM 14,15-EET. As can be seen, the eicosanoid displayed a marked inhibitory effect on Ca2+-dependent tension developed by the explants. CCRC to free Ca2+ concentrations on permeabilized bronchial rings obtained from control and treated bronchi are shown in Figure 3B. Data analysis demonstrates that EET induced a shift in EC50 values (0.91 ± 0.03 µM) toward higher Ca2+ concentrations and thus reduced the Ca2+ hypersensitivity developed in TNF-{alpha}–pretreated bronchi (0.05 ± 0.02 µM) when compared with controls (0.42 ± 0.03 µM) (Figure 3B). Hence, EET treatments reduced the Ca2+ sensitivity of TNF-{alpha}–pretreated bronchi to precalibrated Ca2+ steps in permeabilized explants. This observation also suggests a functional modulation of contractile proteins.


Figure 3
View larger version (15K):
[in this window]
[in a new window]

  		Figure 3. Ca2+ sensitivity is left-shifted in human bronchi, while a concomitant pretreatment with 14,15-EET abolishes this effect. (A) Representative superimposed recordings illustrating the tension induced by cumulative increases in [Ca2+] on β-escin–permeabilized, TNF-{alpha}–pretreated bronchi, either in the absence (black line) or presence of 100 nM 14,15-EET pre-treatments (gray line). (B) CCRC to free [Ca2+] obtained from β-escin–permeabilized bronchial rings in control conditions (closed circles; n = 18), TNF-{alpha}–pretreated bronchi for 48 hours (open circles; n = 21) and TNF-{alpha}–treated bronchi in the presence of 100 nM 14,15-EET added every 12 hours for 48 hours (open squares; n = 21).

 
Effect of 14,15-EET on PDBu-Induced Ca2+ Sensitivity
As seen in Figure 4, 100 nM 14,15-EET reduced the tonic response of β-escin–permeabilized explants to a single Ca2+ step to pCa 6.0 (Figure 4, left panel). Thereafter, PDBu, a direct activator of conventional and novel PKCs, was used to stimulate the PKC/CPI-17 pathway and produce tone increases. Figure 4A (right panel) shows that 100 nM 14,15-EET largely reduced the tension developed upon pCa 6 stimulation in either the absence or presence of 1 µM PDBu, on TNF-{alpha} pre-treated human bronchi. The mean inhibitory effects of 14,15-EET on TNF-{alpha}–treated preparations were further quantified and compared with the mean responses in corresponding conditions (Figure 4B). Data analysis clearly demonstrates that TNF-{alpha} pretreatment significantly increased the tonic responses to pCa 6 and that addition of PDBu further enhanced the mean mechanical response (Figure 4B, left portion). In contrast, 14,15-EET treatments had significant inhibitory effects on each of these experimental conditions (Figure 4B, right portion). Thus, in human bronchi, TNF-{alpha} conditioning as well as the PKC activator were able to increase the mechanical responses to a precalibrated Ca2+ step, while a submicromolar concentration of 14,15-EET largely reduced these positive inotropic effects. The latter observation suggests that the eicosanoid could interact with regulatory proteins of the contractile apparatus.


Figure 4
View larger version (16K):
[in this window]
[in a new window]

  		Figure 4. Effect of 14,15-EET on PDBu-induced tonic responses in β-escin–permeabilized TNF-{alpha}–treated bronchi. (A) Sequential traces display the contractile responses induced by a Ca2+ step to pCa 6.0 (left panel) and pCa 6.0 plus 1 µM PDBu (right panel) on TNF-{alpha}–pretreated bronchi, while the superimposed recordings illustrate the inhibitory effect of 14,15-EET in corresponding experimental conditions (gray lines). (B) Bar histogram of the mean relative responses to 1 µM PDBu in the absence or presence of 14,15-EET (n = 16) on TNF-{alpha}–treated bronchi. Regardless of the experimental condition, 14,15-EET induced a marked inhibitory effect. These results attest that 14,15-EET treatment decreases the tone induced by the Ca2+ step clamp (pCa = 6.0) and PDBu in TNF-{alpha}–pretreated human bronchial rings. *P < 0.05.

 
Phosphorylation Level and Transcript Expression of CPI-17
CPI-17 has previously been reported as a PKC-dependent regulatory protein. In its phosphorylated form, p-CPI-17 displays an inhibitory effect on MLCP, which in turn maintains ASM tone (19, 27, 29). Experiments were therefore designed to assess the status of the regulatory CPI-17 protein in our bronchial inflammatory model. Human bronchial explants were cultured in the absence (control) or presence of either TNF-{alpha} alone or TNF-{alpha} + 14,15-EET. Western blot analysis of the homogenates derived from these preparations revealed that CPI-17 was present in all tested fractions, although TNF-{alpha} treatment increased the density of the 22-kD CPI-17 band, as well as the phosphorylated active form of CPI-17 (14). In contrast, this phosphorylated form was reduced upon 14,15-EET treatment and essentially normalized when compared with nontreated controls (Figure 5A). As can be seen, β-actin staining was constant from one preparation to the other (Figure 5A). Quantitative analysis of identical immunoblot membrane areas were then normalized as a function of total CPI 17 staining in the corresponding fractions. As shown in Figure 5B, 48-hour pretreatment of bronchial explants with 100 nM 14,15-EET largely reduced the P-CPI 17/CPI-17 staining density ratio, when compared with the ratio in TNF-{alpha}–pretreated bronchi (Figure 5B).


Figure 5
View larger version (31K):
[in this window]
[in a new window]

  		Figure 5. Western blot analyses and determination of CPI-17 transcript expression in control, TNF-{alpha}–, and eicosanoid-treated human bronchi. (A) Proteins from three distinct homogenates were stained using specific antibodies against CPI-17, phosphorylated-CPI-17, and β–actin. Note the reduced staining of P-CPI-17 bands in TNF-{alpha} + 100 µM 14,15-EET–treated tissues (third row, following 48-hour treatments), whereas TNF-{alpha} treatment alone displays increased staining. As can be seen, β-actin staining was constant throughout the various preparations. (B) Quantitative analysis of various P-CPI-17 density ratios. Staining densities in the homogenates were expressed as a function of CPI-17 signals. Significant differences were observed between control and TNF-{alpha} alone, and the latter versus TNF-{alpha} + 14,15-EET–treated tissues. Results are representative of six similar experiments, *P < 0.05. (C) RT-PCR analysis performed on control (lane 1), TNF-{alpha}– (lane 2), TNF-{alpha} + EET– (lane 3), and EET (lane 4)-treated human bronchi. Note that detection of CPI-17 fragments was enhanced upon TNF-{alpha} treatment, while EET appeared to normalize the PCR products. Primers against human CPI-17 and GAPDH sequences were used as defined in MATERIALS AND METHODS.

 
To assess the expression level of human CPI 17 transcripts, RT-PCR analysis was performed on four different bronchial preparations as shown in Figure 5C. Total RNAs were extracted from control as well as pretreated explants with either TNF-{alpha}, TNF-{alpha} + EET, or EET alone after a 48-hour culture period. After RT-PCR and agar-gel separation, image analyses revealed a 41% increase in CPI-17 transcript levels in TNF-{alpha}–treated bronchi comparatively to expression levels in control bronchi (Figure 5C, left panel). However, 100 nM 14,15-EET normalized the level of CPI-17 transcript in TNF-{alpha}–treated bronchi. Moreover, RT-PCR analysis revealed a slight reduction in CPI-17 transcript levels in EET-treated bronchi compared with untreated (control) tissues. Parallel experiments, performed with human GAPDH primers, demonstrated a steady-state expression level of this housekeeping gene transcript between control, TNF-{alpha}–, TNF-{alpha} + EET–, and EET-treated tissues (Figure 5A, right panel). These data, representative of four independent experiments, attest that 14,15-EET reduces the expression of CPI-17 transcript in TNF-{alpha}–stimulated tissues, hence corroborating the results obtained from Western blot analysis at the protein level while providing further explanation for the functional results reported above.

14,15-EET Decreases U-46619-Induced Ca2+ Hypersensitivity in TNF-{alpha}–Treated Bronchi
Experiments were performed to assess whether 14,15-EET is able to modulate the Ca2+-sensitivity of the tissues after pharmacologic activation of the Rho-Kinase pathway in TNF-{alpha}–treated bronchi, using the specific activator U-46619 (34). Figure 6A shows that 100 nM 14,15-EET largely reduced the tonic response induced by a pCa2+ step (from pCa2+ 9 to 6) in the presence of 0.3 µM U-46619 after TNF-{alpha} pretreatment. This inhibitory effect of 14,15-EET on the tonic responses of TNF-{alpha}–pretreated explants was further quantified from mean responses, as shown in Figure 6B. Data analysis clearly demonstrates that U-46619 significantly increased the mean tonic response at pCa2+ = 6 (Figure 6B, left portion). Moreover, 14,15-EET pretreatments induced significant inhibitory effects on the mechanical tension developed by explants challenged with either pCa2+= 6 or pCa2+= 6 plus 0.3 µM U-46619 (Figure 6B, right panel). These data suggest that 14,15-EET reduces the overall Ca2+ sensitivity of the contractile machinery in human ASM pretreated with the proinflammatory cytokine.


Figure 6
View larger version (12K):
[in this window]
[in a new window]

  		Figure 6. Effect of 14,15-EET on U-46619-induced responses in permeabilized TNF-{alpha}-treated bronchi. (A) Representative superimposed recordings showing the contractile responses induced by 0.3 µM U-46619 on both TNF-{alpha}– (black line) and TNF-{alpha} + 14,15-EET–pretreated bronchi (gray line). The presence of 14,15-EET in the culture medium largely reduced the tension developed by the cultured bronchi upon pharmacologic challenge. (B) Bar histogram of the relative responses to 0.3 µM U-46619 in the absence or presence of 14,15-EET on TNF-{alpha}–treated bronchi. 14,15-EET induced marked inhibitory effects on pCa = 6 and U-46619–induced tension in TNF-{alpha}–treated bronchi. *P < 0.05, n = 18.

 
Expression of p116Rip, a RhoA-Binding Protein, after EET Pretreatment
p116Rip has previously been reported as an important regulatory component controlling the RhoA signaling pathway, thus regulating MLCP activity and myosin phosphorylation in cells (25). Thus, p116Rip, which displays RhoGAP-like activity, was found to interact with MYPT1 and activate MLCP (26). Herein, experiments were therefore designed to assess the level of p116Rip expression in our model of inflammatory bronchi, namely in control, TNF-{alpha}–, TNF-{alpha} plus EET–, and EET alone–pretreated explants. Western blot analysis of the various bronchial explant homogenates revealed that p116Rip was detected in all tested fractions; however, staining was increased in the 14,15-EET–treated fraction comparatively to control (untreated bronchi) or TNF-{alpha}–pretreated bronchi while β-actin staining remained constant throughout all of the fractions (Figure 7A). Quantitative analysis of identical immunoblot membrane areas were normalized as a function of total β-actin staining in the corresponding fractions. As shown in Figure 7B, 48-hour pretreatment of bronchial explants with 100 nM 14,15-EET significantly increased the p116Rip/β-actin staining density ratio when compared with untreated (control) or TNF-{alpha}–stimulated bronchi. RT-PCR analysis revealed a 65% increase in p116Rip transcript levels in 14,15-EET–treated bronchi compared with levels in corresponding control and TNF-{alpha}–pretreated fractions (Figure 7C, left panel). Similar increases in the p116Rip transcript level were also observed in 14,15-EET–treated bronchi. In contrast, RT-PCR analysis revealed no change in p116Rip transcript level between untreated (control) and TNF-{alpha}–treated bronchi. Control experiments using human GAPDH primers demonstrated a steady-state expression level of this specific gene transcript within the four preparations tested (Figure 7C, right panel). Taken together, these data further corroborate the results obtained from Western blot analysis.


Figure 7
View larger version (39K):
[in this window]
[in a new window]

  		Figure 7. 14,15-EET increases the detection level of p116Rip in both control and TNF-{alpha}–pretreated human bronchi. (A) Western blot analyses of four protein fractions from distinct homogenates using specific antibodies against p116Rip and β-actin. Note the increased staining of p116Rip in 100 µM 14,15-EET– and TNF-{alpha} + 14,15-EET–pretreated bronchi. (B) Quantitative analysis of various p116Rip density ratios in corresponding fractions. Staining densities in the homogenates were expressed as a function of the β-actin signal. Significant differences were observed between 14,15-EET–treated and nontreated control tissues. Results are representative of six similar experiments, *P < 0.05. (C) RT-PCR analysis performed on control (lane 1), TNF-{alpha}– (lane 2), TNF-{alpha} + EET– (lane 3), and EET (lane 4)-pretreated human bronchi. Primers against human p116Rip and GAPDH sequences were used under stringent conditions as defined in MATERIALS AND METHODS.

 

   DISCUSSION
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
References
 
In this study, we investigated the ability of 14,15-EET to reduce the hyperresponsiveness of human bronchi pretreated with a physiologic concentration of TNF-{alpha}. This is the first report directly assessing the intracellular mode of action of this eicosanoid in human lung. 14,15-EET was found to maintain higher levels of I{kappa}B in the corresponding homogenate, likely resulting in a lack of NF-{kappa}B–dependent mediated transcription processes, as previously proposed for explaining anti-inflammatory properties of EET in vascular tissues (35). This effect of EET in TNF-{alpha}–pretreated ASM tissues was correlated with a decrease in myofilament Ca2+-sensitivity and a decrease in CPI-17 protein phosphorylation, as well as an increase in p116Rip detection and expression levels. Thus, we propose that an eicosanoid such as 14,15-EET is able to fine tune the expression of regulatory proteins involved in the modulation of human bronchial tone.

Anti-Inflammatory Effect of 14,15-EET on TNF-{alpha}–Pretreated Bronchi
Bronchial inflammation plays a key role in the pathogenesis of asthma and COPD. There is increasing evidence that TNF-{alpha}, one of the pro-inflammatory cytokines produced by a variety of cells in the airways, including epithelial cells, macrophages, mast cells, and eosinophils (28, 36, 37), is directly linked to airway inflammation and hyper-responsiveness observed in asthma (34). Pharmacologic evidences have also pointed toward an important role of TNF-{alpha} in ASM cell hyperresponsiveness. In this study, TNF-{alpha} (10 ng/ml) pretreatment induced a hyperreactivity to several pharmacologic agonists in short-term cultured human bronchi. In contrast, concentration-dependent isoproterenol relaxations were reduced in TNF-{alpha}–stimulated bronchi, much like asthmatic bronchi (34). Previous studies have shown that TNF-{alpha} treatment of rat and mouse airways induce an increased reactivity of smooth muscle to agonists (29, 31, 32). However, 14,15-EET + TNF-{alpha} treatment reduced the reactivity and sensitivity of bronchial smooth muscle to contractile agonists, whereas relaxing responses to β2-agonist were normalized. Furthermore, EET regioisomers were shown to display protective effects in vascular tissues, including anti-inflammatory, anti-oxidative, anti-migratory, pro-fibrinolytic, and vasodilatory activities (11).

The proinflammatory transcription factor, NF-{kappa}B is essential for the induction of numerous inflammatory mediators in the bronchi. The signaling cascades of NF-{kappa}B activation after stimulation with TNF-{alpha} and IL-1 have been well established in cell cultures (38, 39). Upon cytokine stimulation, the I{kappa}B-kinase complex (IKK) is activated, which in turn phosphorylates I{kappa}B-{alpha}, leading to its ubiquitination and rapid degradation by the 26S proteasome. Detachment and degradation of I{kappa}B-{alpha} is necessary for nuclear translocation of NF-{kappa}B, thus allowing the transcription factor to bind and transactivate corresponding cis-acting elements in target gene promoters (39). Our results demonstrate that 14,15-EET impedes the activation of NF-{kappa}B signaling cascade through the inhibition of I{kappa}B-{alpha} degradation in TNF-{alpha}–treated bronchi. In endothelial cells, 11,12-EET has been shown to inhibit the nuclear translocation of the NF-{kappa}B subunit RelA (16), suggesting that this CYP-450–derived eicosanoid interferes with a proximal step in the NF-{kappa}B signaling cascade. The same investigators also demonstrated that 11,12-EET potently inhibits phosphorylation of I{kappa}B-{alpha} through inhibition of IKK activity (16). Moreover, the same study revealed that upon stimulation with TNF-{alpha}, human endothelial cell surface expression of VCAM-1 is up-regulated and that nanomolar concentrations of 11,12-EET inhibit this TNF-{alpha}–induced expression (16). Recently, it has been reported that, in the presence of AUDA, a soluble epoxide hydrolase inhibitor, EET induces PPAR{gamma} transcriptional activity in endothelial cells (18). The anti-inflammatory effects induced by 14,15-EET in our present acute model of bronchial inflammation may also be mediated by the activation of nuclear receptor PPAR{gamma}, which displays a well-characterized binding site for various PUFA (18). Consequently, the acute pharmacologic relaxing responses, recently reported in human bronchi (14), as well as the anti-inflammatory properties of 14,15-EET assessed herein, may therefore be of physiologic significance in respiratory diseases.

14,15-EET Reduces Ca2+ Hypersensitivity Induced by TNF-{alpha} Pretreatment
Several studies have suggested that Ca2+-sensitizing mechanisms may also be primed under pathophysiologic conditions by various cytokine and lipid mediators (20, 27, 40). It was therefore of potential clinical interest to find a specific agent that would significantly oppose the shift in Ca2+ sensitivity induced by pro-inflammatory cytokines such as TNF-{alpha}. In a previous work, we reported that 14,15-EET induces a reduction in Ca2+ sensitivity in both fresh and hyperreactive guinea pig bronchi, suggesting that this eicosanoid modulates enzymatic systems such as Rho-Kinase and/or PKC/CPI-17 (13). Moreover, in a recent study, we demonstrated that 14,15-EET reduces Ca2+ sensitivity through the inhibition of CPI-17 phosphorylation in human bronchi (14). The present study further reveals that a 48-hour pretreatment with the eicosanoid is able to alter Ca2+ hypersensitivity developed by TNF-{alpha}–stimulated bronchi. Several studies reported similar observations in other biological models. For instance, using primary cultures of ASM cells, it has been shown that TNF-{alpha}, IL-13, and IL-1β directly regulate agonist-associated calcium signaling (41–43). Other cytokines, in addition to TNF-{alpha}, have also been reported to increase Ca2+ responses induced by carbachol, thrombin, and bradykinin (42).

Modulation of Regulatory Protein CPI-17 and p116Rip by EET Treatment
Based on evidences provided in the literature, CPI-17 was a likely candidate for PKC phosphorylation involved in modulating myofilament Ca2+ sensitivity (19, 44). In a previous report, we had shown that, in human bronchi. 14,15-EET pretreatment decreases Ca2+ sensitization induced by PDBu, a PKC activator (14). The present results indicate that in TNF-{alpha}–stimulated bronchi, Ca2+ hypersensitivity is normalized by the concomitant addition of 14,15-EET. Moreover, Western blot analysis performed on TNF-{alpha}–pretreated bronchi homogenates attest that EET pretreatment decreases CPI-17 phosphorylation levels and protein expression. These results were further correlated with a decrease in CPI-17 transcript levels in preparations treated with EET and TNF-{alpha}. Sakai and coworkers (27) have also shown an increase in the expression and activation of CPI-17 in hyperresponsive bronchial smooth muscle from rodents, which in turn may be responsible for the enhanced ACh-induced Ca2+ sensitization of bronchial contraction associated with airway hyperresponsiveness.

Similarly, p116Rip has been shown to be an important regulatory component that controls the RhoA signaling pathway, interacting with MYPT1 and consequently activating MLCP (24, 25). Herein, we show that EET reduces U-46619-induced Ca2+ sensitivity, suggesting that the eicosanoid interacts with the activation of Rho-kinase pathway. We also investigated the status of p116Rip, to determine whether 14,15-EET was able to modulate expression and transcript level of this key RhoA-regulatory protein in human bronchi. The results show that the level of p116Rip protein was largely increased in EET-treated preparations when compared with untreated controls or TNF-{alpha}–pretreated bronchi as assessed by Western blot analysis. These results were also correlated with an increase in transcript levels coding for p116Rip in 14,15-EET–treated bronchi. In contrast, there were no modifications in p116Rip protein and transcript levels detected after 48 hours of pretreatment with TNF-{alpha} alone in this acute inflammatory model of human bronchi, suggesting that the increase in Ca2+ sensitivity brought about by the TP receptor agonist U-46619 in TNF-{alpha}–treated bronchi could not be explained by a decrease in p116Rip expression. However, the Ca2+ hypersensitivity induced by U-46619 in these explants could be explained by an up-regulation of RhoA, induced by pro-inflammatory cytokines, as demonstrated in TNF-{alpha}–treated rat bronchi (30, 31, 40).

In summary, the present study provides evidence that 14,15-EET modulates the mechanical and biochemical properties of ASM in TNF-{alpha}–stimulated human bronchi, whereby 14,15-EET induces a shift in the expression pattern of two regulatory proteins of the contractile machinery. Hence, anti-inflammatory properties could be relayed by the interaction of 14,15-EET with PPAR{gamma}. Altogether, our data support the view and provide new insight into the bronchodilating action of 14,15-EET in human airways, leading to speculation that intracellular eicosanoid receptors could represent new and prospective pharmacologic targets in patients with asthma and COPD.


   Acknowledgments
 
The authors thank Dr. M. Ikebe and Dr. Y. Koga for the gift of the p116Rip antibody, as well as Dr. V. Aires and Mr. Pierre Pothier for critical review of the manuscript and Dr. Edmond Rizcallah and the members of the pathology laboratory for their technical support. E.R. is a member of the Respiratory Health Network of the FRSQ (http://rsr.chus.qc.ca).


   Footnotes
 
This work is supported by a CIHR grant MOP-57677. C.M. is a recipient of a Ph.D. studentship from the NSERC of Canada.

Originally Published in Press as DOI: 10.1165/rcmb.2007-0232OC on September 13, 2007

Conflict of Interest Statement: None of the authors has a financial relationship with a commercial entity that has an interest in the subject of this manuscript.

Received in original form July 19, 2007

Accepted in final form August 17, 2007


   References
Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 

  1. Funk CD. Prostaglandins and leukotrienes: advances in eicosanoid biology. Science 2001;294:1871–1875.[Abstract/Free Full Text]
  2. Roman RJ. P-450 metabolites of arachidonic acid in the control of cardiovascular function. Physiol Rev 2002;82:131–185.[Abstract/Free Full Text]
  3. Zeldin DC, Plitman JD, Kobayashi J, Miller RF, Snapper JR, Falck JR, Szarek JL, Philpot RM, Capdevila JH. The rabbit pulmonary cytochrome P450 arachidonic acid metabolic pathway: characterization and significance. J Clin Invest 1995;95:2150–2160.[Medline]
  4. Chen JK, Wang DW, Falck JR, Capdevila J, Harris RC. Transfection of an active cytochrome P-450 arachidonic acid epoxygenase indicates that 14,15-epoxyeicosatrienoic acid functions as an intracellular second messenger in response to epidermal growth factor. J Biol Chem 1999;274:4764–4769.[Abstract/Free Full Text]
  5. Homma T, Zhang JY, Shimizu T, Prakash C, Blair IA, Harris RC. Cyclooxygenase-derived metabolites of 8,9-epoxyeicosatrienoic acid are potent mitogens for cultured rat glomerular mesangial cells. Biochem Biophys Res Commun 1993;191:282–288.[CrossRef][Medline]
  6. Fleming I, Fisslthaler B, Michaelis UR, Kiss L, Popp R, Busse R. The coronary endothelium-derived hyperpolarizing factor (EDHF) stimulates multiple signalling pathways and proliferation in vascular cells. Pflugers Arch 2001;442:511–518.[CrossRef][Medline]
  7. Medhora M, Daniels J, Mundey K, Fisslthaler B, Busse R, Jacobs ER, Harder DR. Epoxygenase-driven angiogenesis in human lung microvascular endothelial cells. Am J Physiol Heart Circ Physiol 2003;284:H215–H224.[Abstract/Free Full Text]
  8. Michaelis UR, Fisslthaler B, Barbosa-Sicard E, Falck JR, Fleming I, Busse R. Cytochrome P450 epoxygenases 2C8 and 2C9 are implicated in hypoxia-induced endothelial cell migration and angiogenesis. J Cell Sci 2005;118:5489–5498.[Abstract/Free Full Text]
  9. Zhang C, Harder DR. Cerebral capillary endothelial cell mitogenesis and morphogenesis induced by astrocytic epoxyeicosatrienoic acid. Stroke 2002;33:2957–2964.[Abstract/Free Full Text]
  10. Larsen BT, Miura H, Hatoum OA, Campbell WB, Hammock BD, Zeldin DC, Falck JR, Gutterman DD. Epoxyeicosatrienoic and dihydroxyeicosatrienoic acids dilate human coronary arterioles via BK(Ca) channels: implications for soluble epoxide hydrolase inhibition. Am J Physiol Heart Circ Physiol 2006;290:H491–H499.[Abstract/Free Full Text]
  11. Spiecker M, Liao JK. Vascular protective effects of cytochrome p450 epoxygenase-derived eicosanoids. Arch Biochem Biophys 2005;433:413–420.[CrossRef][Medline]
  12. Benoit C, Renaudon B, Salvail D, Rousseau E. EETs relax airway smooth muscle via an EpDHF effect: BKCa channel activation and hyperpolarization. Am J Physiol Lung Cell Mol Physiol 2001;280:L965–L973.[Abstract/Free Full Text]
  13. Morin C, Rousseau E. Effects of 5-Oxo-ETE and 14,15-EET on reactivity and Ca2+ sensitivity in Guinea Pig Bronchi. Prostaglandins Other Lipid Mediat 2007;82:30–41.[CrossRef][Medline]
  14. Morin C, Sirois M, Echave V, Gomes MM, Rousseau E. EET relaxing effects involve BKCa channel activation and CPI-17 dephosphorylation in human bronchi. Am J Respir Cell Mol Biol 2007;36:633–641.[Abstract/Free Full Text]
  15. Somlyo AP, Somlyo AV. Signal transduction by G-protein, rho-kinase and protein phosphatase to smooth muscle and non-muscle myosin II. J Physiol 2000;522:177–185.[Abstract/Free Full Text]
  16. Node K, Huo Y, Ruan X, Yang Y, Spiecker M, Ley K, Zeldin DC, Liao JK. Anti-inflammatory properties of cytochrome P450 epoxygenase-derived eicosanoids. Science 1999;285:1276–1279.[Abstract/Free Full Text]
  17. Fang X, Kaduce TL, Weintraub NL, Harmon S, Teesch LM, Morisseau C, Thompson DA, Hammock BD, Spector AA. Pathways of epoxyeicosatrienoic acid metabolism in endothelial cells: implications for the vascular effects of soluble epoxide hydrolase inhibition. J Biol Chem 2001;276:14867–14874.[Abstract/Free Full Text]
  18. Liu Y, Zhang Y, Schmelzer K, Lee T-S, Fang X, Zhu Y, Spector AA, Gill S, Morisseau C, Hammock BD, et al. The anti-inflammatory effect of laminar flow: the role of PPAR{gamma}, epoxyeicosatrienoic acids, and soluble epoxide hydrolase. Proc Natl Acad Sci USA 2005;102:16747–16752.[Abstract/Free Full Text]
  19. Somlyo AP, Somlyo AV. Ca2+ sensitivity of smooth muscle and nonmuscle myosin II: modulated by G proteins, kinases, and myosin phosphatase. Physiol Rev 2003;83:1325–1358.[Abstract/Free Full Text]
  20. Uehata M, Ishizaki T, Satoh H, Ono T, Kawahara T, Morishita T, Tamakawa H, Yamagami K, Inui J, Maekawa M, et al. Calcium sensitization of smooth muscle mediated by a Rho-associated protein kinase in hypertension. Nature 1997;389:990–994.[CrossRef][Medline]
  21. Shirazi A, Iizuka K, Fadden P, Mosse C, Somlyo AP, Somlyo AV, Haystead TA. Purification and characterization of the mammalian myosin light chain phosphatase holoenzyme. The differential effects of the holoenzyme and its subunits on smooth muscle. J Biol Chem 1994;269:31598–31606.[Abstract/Free Full Text]
  22. Shimizu H, Ito M, Miyahara M, Ichikawa K, Okubo S, Konishi T, Naka M, Tanaka T, Hirano K, Hartshorne DJ. Characterization of the myosin-binding subunit of smooth muscle myosin phosphatase. J Biol Chem 1994;269:30407–30411.[Abstract/Free Full Text]
  23. Kimura K, Ito M, Amano M, Chihara K, Fukata Y, Nakafuku M, Yamamori B, Feng J, Nakano T, Okawa K, et al. Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science 1996;273:245–248.[Abstract]
  24. Surks HK, Richards CT, Mendelsohn ME. Myosin phosphatase-Rho interacting protein, a new member of the myosin phosphatise complex that directly binds RhoA. J Biol Chem 2003;278:51484–51493.[Abstract/Free Full Text]
  25. Koga Y, Ikebe M. p116Rip decreases myosin II phosphorylation by activating myosin light chain phosphatase and by inactivating RhoA. J Biol Chem 2005;280:4983–4991.[Abstract/Free Full Text]
  26. Mulder J, Ariaens A, van Horck FP, Moolenaar WH. Inhibition of RhoA-mediated SRF activation by p116Rip. FEBS Lett 2005;579:6121–6127.[CrossRef][Medline]
  27. Sakai H, Chiba Y, Hirano T, Misawa M. Possible involvement of CPI-17 in augmented bronchial smooth muscle contraction in antigen-induced airway hyper-responsive rats. Mol Pharmacol 2005;68:145–151.[Abstract/Free Full Text]
  28. Gosset P, Tillie-Leblond I, Oudin S, Parmentier O, Wallaert B, Joseph M, Tonnel AB. Production of chemokines and proinflammatory and antiinflammatory cytokines by human alveolar macrophages activated by IgE receptors. J Allergy Clin Immunol 1999;103:289–297.[CrossRef][Medline]
  29. Chung KF. Inflammatory mediators in chronic obstructive pulmonary disease. Curr Drug Targets Inflamm Allergy 2005;4:619–625.[CrossRef][Medline]
  30. Sakai H, Otogoto S, Chiba Y, Abe K, Misawa M. TNF-alpha augments the expression of RhoA in the rat bronchus. J Smooth Muscle Res 2004;40:25–34.[CrossRef][Medline]
  31. Sakai H, Otogoto S, Chiba Y, Abe K, Misawa M. Involvement of p42/44 MAPK and RhoA protein in augmentation of ACh-induced bronchial smooth muscle contraction by TNF-alpha in rats. J Appl Physiol 2004;97:2154–2159.[Abstract/Free Full Text]
  32. Adner M, Rose AC, Zhang Y, Sward K, Benson M, Uddman R, Shankley NP, Cardell LO. An assay to evaluate the long-term effects of inflammatory mediators on murine airway smooth muscle: evidence that TNFalpha up-regulates 5-HT(2A)-mediated contraction. Br J Pharmacol 2002;137:971–982.[CrossRef][Medline]
  33. Godin N, Rousseau E. TRPC6 silencing in primary airway smooth muscle cells inhibits protein expression without affecting OAG-induced calcium entry. Mol Cell Biochem 2007;296:193–201.[CrossRef][Medline]
  34. Mercier F, Morin C, Cloutier M, Proteau S, Rokach J, Powell WS, Rousseau E. 5-Oxo-ETE regulates tone of guinea pig airway smooth muscle via activation of Ca2+ pools and Rho-kinase pathway. Am J Physiol Lung Cell Mol Physiol 2004;287:L631–L640.[Abstract/Free Full Text]
  35. Shah A, Church MK, Holgate ST. Tumour necrosis factor alpha: a potential mediator of asthma. Clin Exp Allergy 1995;25:1038–1044.[CrossRef][Medline]
  36. Ackerman V, Marini M, Vittori E, Bellini A, Vassali G, Mattoli S. Detection of cytokines and their cell sources in bronchial biopsy specimens from asthmatic patients. Chest 1994;105:687–696.[CrossRef][Medline]
  37. Bradding P, Roberts JA, Britten KM, Montefort S, Djukanovic R, Mueller R, Heusser CH, Howarth PH, Holgate ST. Interleukin-4, -5 and -6 and tumor necrosis factor-alpha in normal and asthmatic airways: evidence for the human mast cell as a source of these cytokines. Am J Respir Cell Mol Biol. 1994;10:471–480.[Abstract]
  38. Beg AA, Finco TS, Nantermet PV, Baldwin AS Jr. Tumor necrosis factor and interleukin-1 lead to phosphorylation and loss of I kappa B alpha: a mechanism for NF-kappa B activation. Mol Cell Biol 1993;13:3301–3310.[Abstract/Free Full Text]
  39. Brown K, Gerstberger S, Carlson L, Franzoso G, Siebenlist U. Control of I kappa B-alpha proteolysis by site-specific, signal-induced phosphorylation. Science 1995;267:1485–1488.[Abstract/Free Full Text]
  40. Chiba Y, Misawa M. The role of RhoA-mediated Ca2+ sensitization of bronchial smooth muscle contraction in airway hyperresponsiveness. J Smooth Muscle Res 2004;40:155–167.[CrossRef][Medline]
  41. Tliba O, Deshpande D, Chen H, Van Besien C, Kannan M, Panettieri RA Jr, Amrani Y. IL-13 enhances agonist-evoked calcium signals and contractile responses in airway smooth muscle. Br J Pharmacol 2003;140:1159–1162.[CrossRef][Medline]
  42. Deshpande DA, Walseth TF, Panettieri RA, Kannan MS. CD38/cyclic ADP-ribose-mediated Ca2+ signaling contributes to airway smooth muscle hyperresponsiveness. FASEB J 2003;17:452–454.[Abstract/Free Full Text]
  43. Hunter I, Cobban HJ, Vandenabeele P, MacEwan DJ, Nixon GF. Tumor necrosis factor-alpha-induced activation of RhoA in airway smooth muscle cells: role in the Ca2+ sensitization of myosin light chain20 phosphorylation. Mol Pharmacol 2003;63:714–721.[Abstract/Free Full Text]
  44. Ito S, Kume H, Honjo H, Katoh H, Kodama I, Yamaki K, Hayashi H. Possible involvement of Rho kinase in Ca2+ sensitization and mobilization by MCh in tracheal smooth muscle. Am J Physiol Lung Cell Mol Physiol 2001;280:L1218–L1224.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. Morin, M. Sirois, V. Echave, E. Rizcallah, and E. Rousseau
Relaxing effects of 17(18)-EpETE on arterial and airway smooth muscles in human lung
Am J Physiol Lung Cell Mol Physiol, January 1, 2009; 296(1): L130 - L139.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
C. Morin, M. Sirois, V. Echave, and E. Rousseau
CPI-17 Silencing-Reduced Responsiveness in Control and TNF-{alpha}-Treated Human Bronchi
Am. J. Respir. Cell Mol. Biol., December 1, 2008; 39(6): 638 - 643.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2007-0232OCv1
38/2/192    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morin, C.
Right arrow Articles by Rousseau, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morin, C.
Right arrow Articles by Rousseau, E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2008 American Thoracic Society.