help button home button
AJRCMB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published ahead of print on August 23, 2007, doi:10.1165/rcmb.2007-0045OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supplement
Right arrow All Versions of this Article:
2007-0045OCv1
38/2/227    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kelly, M. M.
Right arrow Articles by Kubes, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kelly, M. M.
Right arrow Articles by Kubes, P.
American Journal of Respiratory Cell and Molecular Biology. Vol. 38, pp. 227-238, 2008
© 2008 American Thoracic Society
DOI: 10.1165/rcmb.2007-0045OC

The Lung Responds to Zymosan in a Unique Manner Independent of Toll-Like Receptors, Complement, and Dectin-1

Margaret M. Kelly1, Kelly McNagny2, David L. Williams3, Nico van Rooijen4, Lori Maxwell5, Carol Gwozd5, Christopher H. Mody6 and Paul Kubes5

1 Department of Pathology and Laboratory Medicine, 5 Department of Physiology, and 6 Department of Medicine, University of Calgary, Calgary, Alberta, Canada; 2 Department of Medical Genetics, University of British Columbia, Vancouver, British Columbia, Canada; 3 Departments of Surgery and Pharmacology, East Tennessee State University, Johnson City, Tennessee; 4 Department of Cell Biology and Immunology, Vrije Universiteit, Amsterdam, The Netherlands

Correspondence and requests for reprints should be addressed to Paul Kubes, Ph.D., Immunology Research Group, Department of Physiology, University of Calgary, Room 1863, 3330 Hospital Drive NW, Calgary, AB, T2N 4N1 Canada. E-mail: pkubes{at}ucalgary.ca


    Abstract
 Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
In vitro studies indicate that the inflammatory response to zymosan, a fungal wall preparation, is dependent on Toll-like receptor (TLR) 2, and that this response is enhanced by the dectin-1 receptor. Complement may also play an important role in this inflammatory response. However, the relevance of these molecules within the in vivo pulmonary environment remains unknown. To examine pulmonary in vivo inflammatory responses of the lung to zymosan, zymosan was administered by intratracheal aerosolization to C57BL/6, TLR2- TLR4-, MyD88-, and complement-deficient mice. Outcomes included bronchoalveolar fluid cell counts. We next examined effects of dectin-1 inhibition on response to zymosan in alveolar macrophages in vitro and in lungs of C57BL/6, TLR2-, and complement-deficient mice. Finally, the effect of alveolar macrophage depletion on in vivo pulmonary responses was assessed. Marked zymosan-induced neutrophil responses were unaltered in TLR2-deficient mice despite a TLR2-dependent response seen with synthetic TLR2 agonists. TLR4, MyD88, and complement activation were not required for the inflammatory response to zymosan. Although dectin-1 receptor inhibition blocked the inflammatory response of alveolar macrophages to zymosan in vitro, in vivo pulmonary leukocyte recruitment was not altered even in the absence of TLR2 or complement. Depletion of alveolar macrophages did not affect the response to zymosan. Neither complement, macrophages, nor TLR2, TLR4, MyD88, and/or dectin-1 receptors were involved in the pulmonary in vivo inflammatory response to zymosan.

Key Words: lung diseases • alveolar macrophage • fungus • neutrophils



    CLINICAL RELEVANCE
 Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
The pulmonary innate immune response to zymosan, a fungal wall extract, was found to be independent of complement, Toll-like receptor 2, and/or dectin-1 (unlike in vitro studies), and emphasizes the need for more studies on the response to fungal infections in the lung.

 
Fungal infections of the lung are a major clinical problem in immunocompromised patients and are associated with high mortality rates (1, 2). The innate immune response plays a vital role in limiting fungal infection in the lung by releasing mediators that recruit large numbers of neutrophils from the circulation to kill the fungal organisms (3, 4). Alveolar macrophages constitute approximately 95% of airway and alveolar leukocytes and are ideally located for early pathogen detection (5). These cells are considered to be the major innate immune cell in the lung, with the ability to recognize, phagocytose, and kill nonopsonized fungi that have entered the lower respiratory tract. However, mast cells, bronchiolar and alveolar epithelial cells, dendritic cells, fibroblasts, and endothelial cells are also able to function as resident innate immune cells (611). Neutrophils are innate immune cells that can traffick rapidly to the lung from the circulation in response to inflammatory stimuli. Innate immune cells recognize pathogen-associated molecular patterns by their pattern recognition receptors, including Toll-like receptors (TLRs) (1214) and C-type lectins such as the dectin-1 receptor (15, 16). Dectin-1 is highly expressed on alveolar macrophages (1719) and is also expressed on dendritic cells, neutrophils, and mast cells (17, 19). Downstream of TLRs is MyD88, a cytoplasmic adaptor protein that mediates almost all TLR signaling with activation of nuclear factor-{kappa}B and the initiation of the inflammatory cascade (20).

Zymosan, a cell wall preparation of the fungal organism Saccharomyces cerevisiae, has been widely used as a model of fungal-mediated inflammation, initiating phagocytosis and the production of inflammatory cytokines and chemokines (21, 22). Zymosan activates complement via the alternative pathway to generate proinflammatory products (2325). C5a is a potent chemoattractant for neutrophils and plays an important role in pulmonary neutrophil sequestration in sepsis (26). Increased understanding of zymosan recognition by the innate immune system has come from in vitro studies in macrophage cell lines (22, 27, 28). Initial studies indicated that the inflammatory response to zymosan was dependent on the presence of TLR2 (27, 2931), but subsequent studies have shown a requirement for presence of the dectin-1 receptor (22, 32, 33). Dectin-1 has also been implicated in the response to fungal organisms such as Candida, Aspergillus, and Pneumocystis (18, 22, 3338). Although it is clear that dectin-1 can signal independently of TLRs (32, 39), other studies have shown that dectin-1 and TLR2 can have collaborative effects on the inflammatory response (21, 40) and suggest that TLR2 is required for optimal dectin-1–mediated TNF-{alpha} production (34, 38).

Two recent publications in the same issue of Nature Immunology highlight the in vitro variability in responses to zymosan (33, 41). One study showed that the release of TNF-{alpha} from thioglycollate-elicited peritoneal macrophages stimulated with zymosan in vitro was dependent on dectin-1 (33); the second study showed that the release of TNF-{alpha} from the same cells was independent of dectin-1 but dependent on MyD88 (41). Only one of these studies reported in vivo data with zymosan, concluding that the response in the peritoneum was dependent on dectin-1 (33). The discordant conclusions reached in various in vitro studies likely relate to the use of different cell lines and protocols and underscores the importance of systematically examining the innate immune response not just in vivo but in specific organs such as the lung, where innate immune primary responses may be unique. Moreover, the relative importance of these mechanisms in zymosan-induced lung inflammation in vivo is difficult to predict from the discordant in vitro studies.

The objective of the current study was to examine the relevance of a number of receptors potentially involved in the innate immune response of the lung in vivo. We systematically examined the roles of TLR2, TLR4, MyD88, complement, and dectin-1 in a physiologically relevant model whereby zymosan was administered intratracheally as an aerosol to the murine lung. Finally, we examined the role of the alveolar macrophages in this response. Some of the results of this study have been published in the form of abstracts (42, 43).


    MATERIALS AND METHODS
 Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Materials
The following reagents were used: zymosan A; laminarin (a soluble β-glucan from the seaweed Laminaria digitata); Dulbecco's pyrogen-free phosphate buffered saline (PBS) (all from Sigma Chemical Co., St. Louis, MO); fluorescently labeled zymosan (Alexa Fluor 594; Molecular Probes, Carlsbad, CA); endotoxin (Escherichia coli 0111:B4; Calbiochem, San Diego, CA); dectin-1 fusion protein, containing mutated human IgG1 Fc (s-dectin-hFc; a kind gift from Dr Gordon Brown, University of Cape Town, Cape Town, South Africa) (34, 44); glucan phosphate (prepared as previously described [45]); synthetic TLR2 agonists, macrophage-activating lipopeptide-2 (Malp-2) and Pam3Cys-Ser-(Lys)4.3HCL (Pam3Cys) (both from Alexis, San Diego, CA); and liposome-encapsulated dichloromethylene diphosphonate (clodronate liposomes), prepared as previously described (46). Clodronate was a gift of Roche Diagnostics GmbH (Mannheim, Germany). Reagents were diluted in pyrogen-free saline. Unless otherwise noted, general reagents were from Sigma. Immediately before administration, zymosan was sonicated for half an hour.

Animals
C57BL/6, TLR2-deficient, C3-deficient (B6.129S4-C3tm1Crr/J), and TLR4-deficient (C57BL/10ScNJ) mice were obtained from the Jackson Laboratory (Bar Harbor, ME). MyD88-deficient and C5aR-deficient mice were kind gifts from Dr. Akira (Osaka University, Osaka, Japan) and Dr. Craig Gerard (Harvard Medical School, Boston, MA), respectively. All mice were on a C57BL/6 background unless otherwise stated. All mice (weighing 25–30 g and 6–10 wk of age) were housed in environmentally controlled specific pathogen–free conditions for at least 1 week before experiments. Animal protocols were approved by the University of Calgary Animal Care Committee and were performed in accordance with the Canadian Council of Animal Care guidelines.

Intratracheal Aerosolization
Mice were anesthetized with isoflurane (MTC Pharmaceuticals, Cambridge, ON, Canada) and suspended from their upper front teeth in a vertical, upright position. Oral intratracheal intubation was achieved under direct visualization using an operating microscope and a small animal laryngoscope (Penn-Century, Philadelphia, PA). Solutions were aerosolized directly into the distal trachea using a MicroSprayer (Model IA-1C; Penn-Century) attached to a stainless steel syringe (FMJ-250; Penn-Century).

The total doses of reagents administered per aerosolization were 50 µg endotoxin; 10, 100, and 200 µg zymosan; 2.5 µg Malp-2; 50 µg Pam3Cys; 1,000 µg laminarin; 1 µg s-dectin-hFc; 400 µg glucan phosphate; and 25 µg clodronate liposomes. Endotoxin, Malp-2, and Pam3Cys were administered in a volume of 50 µl. The volume of zymosan administered was 50 µl except where it was administered with or subsequent to laminarin, s-dectin-hFc, glucan phosphate, or clodronate liposomes, in which case the total volume aerosolized was 100 µl. The total dose of zymosan, however, was constant (100 µg). The doses of zymosan, endotoxin, Malp-2, Pam3Cys, laminarin, and s-dectin-hFc used were based on previous studies in the rodent lung (34, 47, 48) or on dose–response experiments done by us (see Figure E1 in the online supplement). The dose of glucan phosphate was selected as the maximum dose that failed to produce an inflammatory response in preliminary experiments (data not shown).

In Vivo Experiments
To demonstrate the effectiveness of intratracheal aerosolization, 100 µg of fluorescently labeled zymosan in 50 µl was administered to C57BL/6 mice and the mice harvested at 24 hours. The lungs were inflated with 50% vol/vol mixture of Tissue-Tek OCT (Sakura Finetek, Torrance, CA) in PBS, frozen on dry ice, and stored at –70°C. Tissue blocks were subsequently sectioned at 6 µm, mounted on clean glass slides, and examined using a fluorescent microscope to confirm alveolar deposition of zymosan granules.

To examine the kinetics of the inflammatory response to intratracheal zymosan, mice were harvested at 6 hours, 24 hours, 48 hours, 4 days, and 7 days after aerosolization. To examine the effect of different doses of zymosan at 6-hour and 24-hour time points, aerosolization with 10 and 100 µg of zymosan in C57BL/6, TLR2-deficient, and C5aR-deficient mice was examined. Subsequently all other outcomes were at 24 hours after aerosolization of zymosan, which was administered by intratracheal aerosolization to C57BL/6 mice and the deficient strains described above. Dectin-1 inhibitors (laminarin, s-dectin-hFc, and glucan phosphate), were administered to C57BL/6 mice to examine the role of the dectin-1 receptor in the response to zymosan. Zymosan was mixed with laminarin and immediately aerosolized into the lungs; s-dectin-hFc was incubated with zymosan at 4°C for an hour before the mixture was aerosolized; glucan phosphate was aerosolized 2 hours before aerosolization of zymosan to allow initial inhibition of dectin-1 receptors. Saline controls were used where appropriate. S-dectin-hFc and zymosan were aerosolized to TLR2-deficient and C3-deficient mice to detect possible interactions of dectin-1 with TLR2 or C3 in the inflammatory response. In order to deplete alveolar macrophages, we delivered 100 µl of clodronate liposomes by intratracheal aerosolization 2 days before zymosan or saline intratracheal aerosolization, and the bronchoalveolar lavage (BAL) fluid was harvested 24 hours later.

BAL
The trachea was exposed and cannulated using a blunted 18-gauge needle and BAL was performed. Four aliquots of 500-µl pyrogen-free Dulbecco's PBS were injected and withdrawn. BAL fluid cells were counted using a standard hemocytometer followed by centrifugation at 300 x g for 5 minutes with the supernatant stored at –80°C for later analysis of protein expression of TNF-{alpha} (ELISA, DuoSet; BD Pharmingen, San Diego, CA) and monocyte inflammatory protein (MIP)-1{alpha}, macrophage chemoattractant protein 1 (MCP-1), keratinocyte chemoattractant (KC), and IL-6 (Luminex xMAP system [Toronto, ON, Canada] with antibodies from Biosource Invitrogen [Camarillo, CA]) according to the manufacturer's instructions. The cell pellet was resuspended in 100 µl of PBS and cytocentrifuge slides prepared and stained with hematoxylin and eosin (H&E) (Cytospin 3; Shandon Scientific, Sewickley, PA). Differential cell counts were performed on 400 cells by one investigator blind to the experimental conditions.

Histology of Lungs
In one group of mice, 24 hours after saline or zymosan intratracheal aerosolization, the mice were harvested with the heart and lungs removed en bloc from the thoracic cavity as previously described (49). The lungs were inflated with 10% neutral buffered formalin, the trachea tied off, and the lungs placed in formalin for 24 to 48 hours for subsequent paraffin embedding. Sections were cut at 4 µm and stained with H&E and chloroacetate esterase (Leder stain; Sigma) for histologic assessment using light microscopy in a blinded fashion.

In Vitro Experiments
In order to confirm that dectin-1 inhibitors were able to block the alveolar macrophage inflammatory response to zymosan in vitro, we harvested alveolar macrophages from C57BL/6 mice by BAL. We also administered dectin-1 inhibitors by intratracheal aerosolization and subsequently harvested the alveolar macrophages and exposed them to zymosan in vitro to demonstrate that our protocol was effective in blocking the dectin-1 receptors on alveolar macrophages. The BAL fluid was pooled and centrifuged at 300 x g for 10 minutes and the cells collected. To ensure that each cell preparation was enriched for macrophages, a cytospin was prepared and greater than 98% enrichment for alveolar macrophages was confirmed. The alveolar macrophages (5 x 105) were transferred to 24-well plates in RPMI with 5% fetal calf serum and allowed to adhere overnight in 5% CO2 at 37°C. After removing nonadherent cells, the cells were incubated in serum-free RPMI with PBS, laminarin (500 µg/ml), s-dectin-hFc (10 µg/ml), or glucan phosphate (100 µg/ml) for 60 minutes at 4°C, washed, and then stimulated with either PBS or zymosan (100 µg/ml) for 4 hours at 37 °C. The cultured cells were then lysed and total RNA extracted (Trizol; Life Technologies, Bethesda, MD), DNA removed (DNA-Free; Ambion, Austin, TX), and the extracted RNA subjected to oligodT primed reverse-transcriptase reaction with Superscript III (Invitrogen, Burlington, ON, Canada) according to the manufacturer's recommendations. cDNA was then subjected to multiplex PCR with target-specific primers or real-time quantitative PCR (Taqman; Applied Biosytems, Foster City, CA).

Quantitative Real-Time PCR
Quantitative real-time PCR was performed on an ABI 7700 (Applied Biosystems) using TaqMan Universal PCR Master Mix (Applied Biosystems). Probes labeled with 5' FAM and 3' TAMRA modifications were used at a final concentration of 0.9 mM, and primers were used at 0.2 mM (GIBCO, Burlington, ON, Canada). The PCR program was as follows: 50°C for 2 minutes and 95°C for 10 minutes (95°C for 15 s and 60°C for 1 min) for 40 cycles. All data were normalized to GAPDH expression in the same cDNA set. Data is presented in relative mRNA units and represents the average of at least three values ± SEM. Each experiment was performed independently at least three times. Sequences for the IL-6 probes and primers were designed using PrimerExpress software (Applied Biosystems) and are as follows: IL-6 probe: TCTGCAAGAGACTTCCATCCAGTTGCC; forward primer: CCAGAAACCGCTATGAAGT-TCT; reverse primer: CACCAGCATCAGTCCCAAGA (Sigma). The probes and primers for GAPDH (Part Number 4352932E), IL-1β, and TNF-{alpha} (Assays on demand) were obtained from Applied Biosystems.

Statistical Analysis
Data were analyzed using SPSS version 11.0.0 (SPSS Inc., Chicago, IL). Reported values are expressed as mean and SEM unless otherwise described. Normality and variance assumptions were tested for all variables. Comparisons between control and experimental mice, with respect to BAL cell counts, TNF-{alpha} measurements, and gene expression, were made using ANOVA. Bonferroni's post hoc multiple comparisons testing was performed to detect significant differences. All comparisons were two-tailed, and P values less than 0.05 were considered to be significant.


    RESULTS
 Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
Diffuse Distribution of Intratracheal Aerosolized Zymosan
Numerous modes of zymosan administration were tested, and intratracheal aerosolization with a Microsprayer attached to a stainless steel syringe achieved optimal results. To demonstrate the effectiveness of intratracheal aerosolization using this method, fluorescently labeled zymosan was administered to C57BL/6 mice. Sections of lung examined revealed diffuse, relatively even distribution of fluorescent zymosan particles throughout both lungs, thereby confirming appropriate intrapulmonary delivery of the reagent (Figure 1A).


Figure 1
View larger version (111K):
[in this window]
[in a new window]

 
Figure 1. (A) Pulmonary distribution of fluorescently labeled zymosan particles. Fluorescently labeled zymosan (Alexa Fluor 594) was administered by intratracheal aerosolization to C57BL/6 mice (100 µg in 50 µl). Sections of lung reveal a diffuse, relatively even distribution of particles throughout both the right and left lungs. A representative section of lung is illustrated. Cell nuclei labeled with DAPI are shown in blue, zymosan particles in red. Images were captured as 8-bit tiffs, with one image taken per channel. Images were then imported into ImageJ, the background subtracted, and then the red and blue channels combined into a single RGB image. Magnification: x40. (B) Cytospin of bronchoalveolar lavage (BAL) fluid cells 24 hours after intratracheal aerosolization of zymosan. Cells in BAL fluid, consisting mainly of neutrophils and some macrophages, are present and many cells contain numerous phagocytosed zymosan granules. Hematoxylin and eosin stain. Magnification: x600. Histologic sections of mouse lung 24 hours after intratracheal aerosolization. Intratracheal aerosolization of saline (C and D) or 100 µg zymosan (E and F) (50 µl) was performed and mice were killed 24 hours later; the lungs were inflated, fixed in formalin, and paraffin blocks obtained. Subsequently sections were cut and stained with chloroacetate esterase, which stains neutrophils red. Representative sections show alveolar spaces mainly devoid of cells in the saline-treated lungs (C and D), while many alveolar spaces are packed with neutrophils in the zymosan-treated lungs, with marked neutrophil accumulation around the bronchovascular structures (E and F). Original magnifications: C and E, x200; D, x400; F, x900 (all chloroacetate esterase stain).

 
Dose of Intratracheal Aerosolized Zymosan
Intratracheal aerosolization with three different doses of zymosan (10, 100 and 200 µg) was examined and showed progressively increasing inflammatory responses (Figure E1). The dose of 100 µg was selected for most experiments, as it elicited a robust but submaximal inflammatory response.

The Kinetics of the Pulmonary Inflammatory Response to Zymosan
Intratracheal aerosolization of zymosan induced a marked neutrophil response in BAL fluid, with cytospins confirming ingestion of zymosan granules by macrophages and neutrophils (Figure 1B). In mice that did not undergo BAL, examination of histologic sections confirmed the large influx of neutrophils into the lung after zymosan administration (Figures 1E and 1F) compared with saline (Figures 1C and 1D).

In a time-course experiment, BAL fluid was harvested 6, 24, and 48 hours as well as 4 and 7 days after zymosan administration (Figure 2). A neutrophil influx was noted within 6 hours with a sustained increase at 24 to 48 hours but then declining by 4 days and back to baseline by 7 days. The total number of neutrophils in the BAL fluid increased approximately 200-fold 24 hours after zymosan exposure compared with control values (Figure 2B), with the percentage of neutrophils constituting an average of 83.9% of the total cells compared with 5.9% in controls (Figure 2A). The remaining cells consisted predominantly of macrophages. The neutrophil response persisted for at least 4 days, but the inflammatory influx had completely resolved by Day 7 (Figure 2B).


Figure 2
View larger version (18K):
[in this window]
[in a new window]

 
Figure 2. Kinetics of neutrophil response in the lung in response to zymosan aerosolization. Zymosan (shaded bars) was administered to C57BL/6 mice (n = 3–11/group) by intratracheal aerosolization and BAL fluid obtained at 6 hours, 24 hours, 48 hours, 4 days, and 7 days after exposure, respectively. (A) Percentage neutrophils, (B) total neutrophils, (C) release of TNF-{alpha} protein, (D) monocyte inflammatory protein (MIP)-1{alpha}, (E) macrophage chemoattractant protein (MCP), (F) keratinocyte chemoattractant (KC), and (G) IL-6 in the BAL fluid are illustrated. Mice were also aerosolized with pyrogen-free saline as a control (open bars). A neutrophil influx was noted within 6 hours, with a sustained increase at 24 to 48 hours, but then declining by 4 days and back to baseline by 7 days. However, the release of TNF-{alpha}, MIP-1{alpha}, KC, and IL-6 reached maximal levels within the first 24 hours. MCP started to rise only after 6 hours, remained elevated at 24 to 48 hours, and then returned to baseline by 4 to 7 days. *P < 0.05 compared with 24-hour and 48-hour time points; #P < 0.05 compared with saline control, zymosan at 24-hour, 48-hour, 4-day, and 7-day time points; {ddagger}P < 0.05 compared with saline control, 4-day and 7-day time points.

 
The release of TNF-{alpha}, MIP-1{alpha}, KC, and IL-6 reached maximal levels within the first 24 hours, but progressively declined thereafter (Figures 2C, 2D, 2F, and 2G). MCP started to rise only after 6 hours, remained elevated at 24 to 48 hours, and then returned to baseline by 4 to 7 days (Figure 2E).

Since maximal neutrophil recruitment occurred after 6 hours but within 4 days after intratracheal aerosolization, we elected to examine outcomes at 24 hours. The pattern of inflammatory response was similar in magnitude and cell type to that seen with aerosolization of the lungs with endotoxin (Figures 3A–3C). To exclude the possibility that the neutrophil response to zymosan was due to the presence of contaminating pyrogens such as endotoxin in the zymosan preparation, this was passed through a 0.2-µm filter to remove zymosan particles and the filtrate aerosolized (Figure 3). Removal of the zymosan particles abolished the inflammatory response, confirming that it was not elicited by any soluble contaminating pyrogens.


Figure 3
View larger version (11K):
[in this window]
[in a new window]

 
Figure 3. In vivo pulmonary neutrophil response to zymosan is comparable to endotoxin, but not due to contamination with pyrogens. Zymosan (100 µg; solid bars), zymosan filtrate (100 µg zymosan was passed through a 2-µm filter and the filtrate recovered; light gray bars), or endotoxin (50 µg; dark gray bars) were administered by intratracheal aerosolization to C57BL/6 mice and BAL fluid obtained 24 hours after exposure. The volume aerosolized in each case was 50 µl. (A) Percentage neutrophils, (B) total neutrophils, and (C) release of TNF-{alpha} protein in the BAL fluid are illustrated. The magnitude and type of inflammatory response to zymosan was similar to that of endotoxin. Contamination of the zymosan suspension with endotoxin or other pyrogens was ruled out by demonstrating that the soluble fraction of the zymosan solution alone was unable to induce an inflammatory response (light gray bars). Mice were aerosolized with pyrogen-free saline as a control (open bars) (n = 3–11/group). *P < 0.05 compared with saline controls.

 
The In Vivo Pulmonary Inflammatory Response to Zymosan Is Independent of TLR2
We administered zymosan by intratracheal aerosolization to TLR2-deficient mice as studies from in vitro experiments demonstrated zymosan to activate macrophages via TLR2 (27, 2931). In contrast, we found that there was no reduction in the inflammatory response compared to that seen in C57BL/6 mice after 24 hours (Figures 4A–4C). To demonstrate that the lung can respond to TLR2-dependent stimuli, we next delivered the synthetic TLR2 agonists Malp-2 and Pam3Cys by intratracheal aerosolization to C57BL/6 and TLR2-deficient mice. The neutrophil inflammatory response present in wild-type mice administered TLR2 agonists was markedly inhibited in TLR2-deficient mice, confirming that the lung can generate a TLR2-dependent inflammatory response (Figure 4). We compared the inflammatory response at 6 and 24 hours in TLR2-deficient mice and noted no significant reduction in the neutrophil influx or in any other inflammatory parameter compared with C57BL/6 mice (Figure E3). In addition, we administered a lower dose of zymosan (10 µg) to TLR2-deficient mice at 6 and 24 hours (Figure E2), and observed no significant difference in the inflammatory response compared with C57BL/6 mice. Taken together, these data demonstrate that the response to zymosan is independent of TLR2 in our in vivo lung model.


Figure 4
View larger version (10K):
[in this window]
[in a new window]

 
Figure 4. In vivo pulmonary neutrophil response to zymosan preserved in Toll-like receptor (TLR)2-deficient mice despite lack of response with TLR2 agonists. Synthetic TLR2 agonists, Malp-2 (2.5 µg) or Pam3Cys (50 µg), (50 µl volumes), were administered by intratracheal aerosolization to C57BL/6 (open bars) and TLR2-deficient (solid bars) mice and BAL fluid obtained 24 hours after exposure. (A) Percentage neutrophils, (B) total neutrophils, and (C) release of TNF-{alpha} protein in the BAL fluid are illustrated (n = 3–4/group). The neutrophil and TNF-{alpha} response to the TLR2 agonists was absent in TLR2-deficient mice as expected, but the response to zymosan was preserved, with no difference in cell counts in the different strains of mice. The expected responses to the synthetic TLR2 agonists demonstrated the validity of our model system. NS = no significant difference; *P < 0.05.

 
The In Vivo Pulmonary Inflammatory Response to Zymosan Is Independent of TLR4 and MyD88
We next administered intratracheal zymosan to MyD88-deficient mice and noted a neutrophil response comparable with that in C57BL/6 mice (Table 1). Since MyD88 is an adaptor protein necessary for signaling of most TLRs, including TLR2, these data provide further evidence that TLR2 is not required for the inflammatory response to zymosan in vivo. Given that TLR4 can signal independently of MyD88, we administered intratracheal zymosan to TLR4-deficient mice and again confirmed a neutrophil response similar to that seen in C57BL/6 mice. This neutrophil response in the BAL fluid was associated with increased protein expression of TNF-{alpha}, MIP-1{alpha}, MCP, KC, and IL-6 (Table 1). Therefore TLRs do not appear to be necessary for the inflammatory response to zymosan.


View this table:
[in this window]
[in a new window]

 
TABLE 1. IN VIVO PULMONARY INFLAMMATORY RESPONSE TO ZYMOSAN IN C57BL/6, TLR2-DEFICIENT, TLR4-DEFICIENT, MYD88-DEFICIENT, C3-DEFICIENT, AND C5AR-DEFICIENT MICE

 
The In Vivo Pulmonary Inflammatory Response to Zymosan Is Independent of Complement
Since zymosan can activate the complement pathway and generate the neutrophil chemoattractant C5a (2325), we administered zymosan to complement-deficient mice. The classical, alternative, and lectin pathways of complement activation all converge at C3 to generate C3a and C5a. C3-deficient mice would thus be expected to be unable to generate C5a. However, it has recently been shown that in the absence of C3, thrombin has C5 convertase activity and can generate C5a (50). C5 can be synthesized by alveolar macrophages (51); therefore, we administered intratracheal zymosan to both C3-deficient and C5a receptor (C5aR)-deficient mice. In both cases we observed a marked neutrophil response in the BAL fluid, which was of a similar magnitude to that of wild-type mice (Table 1). In addition, the release of TNF-{alpha}, MIP-1{alpha}, KC, and IL-6 into the BAL fluid showed similar kinetics to the neutrophil influx, and was not reduced in either group compared with wild-type mice (Table 1).

We also compared the inflammatory response at 6 and 24 h in C5aR-deficient mice and found no decrease in the neutrophil influx or in any other inflammatory parameter compared with C57BL/6 mice (Figure E3). We also administered a lower dose of zymosan (10 µg) to C5aR-deficient mice at 6 and 24 h (Figure E2), with similar results as for the 100-µg dose. Thus complement is not an essential mediator in pulmonary leukocyte recruitment in response to zymosan.

The In Vivo Pulmonary Inflammatory Response to Zymosan Is Not Reduced by Dectin-1 Inhibitors
Since the in vivo inflammatory response to zymosan was independent of complement and TLRs, we investigated the role of the dectin-1 receptor, since previous in vitro studies have concluded that it plays a critical role (22, 32, 33). To do this, we administered, separately, laminarin, a soluble fusion protein (s-dectin-hFc), and purified glucan phosphate, which have all been reported to inhibit the dectin-1 receptor (52, 53). The purified form of glucan phosphate has a high affinity for the dectin-1 receptor (53), with which it complexes and becomes internalized (22, 54). The receptor is unable to recycle to the cell surface, and its expression is only re-established once dectin-1 has been re-synthesized (22, 55). It has been shown that the expression of dectin-1 is inhibited in up to 85% of circulating leukocytes within hours of administration, and that this is sustained for several days after a single systemic injection (56). Laminarin or s-dectin-hFc were mixed with zymosan and then administered as a single aerosol to ensure delivery to the same part of the lung. Since zymosan binds to both s-dectin-hFc and the dectin-1 receptor (53), s-dectin-hFc and zymosan were initially incubated together at 4°C for 1 hour before aerosolization. Glucan phosphate was adminstered by intratracheal aerosol 2 hours before intratracheal aerosolization with zymosan to initially inhibit dectin-1 receptors. Saline controls were also administered and the inflammatory response was examined 24 hours later as before. Administration of laminarin, s-dectin-hFc, or glucan phosphate alone did not produce an increase in the neutrophil response after 24 hours (Figures 5A and 5B) or an increase in release of TNF-{alpha} (Figure 5C). There was no significant difference in the neutrophil response to zymosan whether or not dectin-1 inhibitors were administered (Figures 5A and 5B). In fact, there was an increase in TNF-{alpha} release compared to zymosan alone, when laminarin was co-adminstered with zymosan (Figure 5C). These results are most consistent with a dectin-1–independent mechanism in the lung being responsible for the pulmonary inflammatory response to zymosan.


Figure 5
View larger version (17K):
[in this window]
[in a new window]

 
Figure 5. In vivo pulmonary neutrophil response to zymosan not inhibited by intratracheal aerosolization of dectin-1 inhibitors. Zymosan (100 µg; shaded bars) was administered by intratracheal aerosolization to C57BL/6 mice alone or with laminarin (1,000 µg) or s-dectin-hFc (1 µg) in a total volume of 100 µl. Zymosan and s-dectin-hFc were incubated together for 1 hour at 4°C before administration. Glucan phosphate (GP) (400 µg in 100 µl) or saline control (open bars) was administered by intratracheal aerosolization 2 hours before zymosan or saline administration. The dose of glucan phosphate was selected as the maximum dose that did not produce an inflammatory response in preliminary experiments (data not shown). BAL fluid was harvested after 24 hours. (A) Percentage neutrophils, (B) total neutrophils, and (C) TNF-{alpha} protein levels in the BAL fluid are illustrated (n = 3–6/group). Laminarin, s-dectin-hFc, or glucan phosphate alone did not increase leukocyte recruitment. The neutrophil or TNF-{alpha} response to zymosan was not reduced significantly by administration of any of these dectin-1 inhibitors, and laminarin significantly increased the release of TNF-{alpha} (C). These findings suggest that pulmonary neutrophil recruitment is independent of the dectin-1 receptor (although laminarin may not be a good inhibitor of dectin-1, at least in vitro; see Figures 6 and E4). NS = no significant difference; *P < 0.05; #reagent given 2 hours before zymosan.

 
Inhibition of the In Vitro Inflammatory Response to Zymosan by s-Dectin-hFc and Glucan Phosphate
The lack of an inhibitory effect of laminarin, s-dectin-hFc, or glucan phosphate on the inflammatory response to zymosan prompted us to confirm that these reagents were able to block the in vitro inflammatory response to zymosan. Alveolar macrophages were harvested from the BAL fluid of C57BL/6 mice and incubated with saline, laminarin, s-dectin-hFc, or glucan phosphate, followed by stimulation with zymosan. The inflammatory response was analyzed by semiquantitative gene expression of the inflammatory cytokines IL-6, IL-1β, and TNF-{alpha}. We found that s-dectin-hFc and glucan phosphate, but not laminarin, significantly reduced the inflammatory gene expression and therefore substantially inhibited the in vitro inflammatory response to zymosan (Figures 6A–6C). These findings are in agreement with other in vitro studies, which suggest that the dominant receptor on alveolar macrophages is dectin-1 (33, 57). The lack of inhibitory effect of laminarin was further confirmed by multiplex gene expression for inflammatory cytokines IL-6, IL-1β, GM-CSF, TNF-{alpha}, and IL-12p40, which were up-regulated to a similar degree when the alveolar macrophages were incubated with or without laminarin before zymosan stimulation (see Figure E4 in the online supplement).


Figure 6
View larger version (15K):
[in this window]
[in a new window]

 
Figure 6. In vitro alveolar macrophage inflammatory response to zymosan inhibited by s-dectin-hFc and glucan phosphate but not laminarin. Alveolar macrophages harvested from C57BL/6 mice were incubated with laminarin (500 µg/ml), s-Dectin-hFc (10 µg/ml), or glucan phosphate (100 µg/µl), or saline control, for 60 minutes at 4°C and then stimulated with zymosan (100 µg/ml; shaded bars) or saline control (open bars) for 4 hours at 37°C. RNA extracted from the cells was reverse-transcribed and underwent real-time quantitative (Taqman) PCR for IL-6, IL-1β, and TNF-{alpha} gene expression (A–C) with GAPDH as control. Prior incubation with s-dectin-hFc or glucan phosphate, but not laminarin, inhibited the zymosan-induced gene up-regulation (n = 3–5 in each group). Data were reproducible in three independent experiments. *P < 0.05; NS = no significant difference.

 
Inhibition of Dectin-1 Receptors in the Lung by Intrapulmonary Glucan Phosphate
In order to demonstrate that administration of glucan phosphate by intratracheal aerosol effectively inhibited dectin-1, we harvested alveolar macrophages from BAL fluid 24 hours after glucan phosphate administration. The alveolar macrophages were cultured and stimulated with zymosan as described previously. Inhibition of gene upregulation of IL-6, IL-1β, and TNF-{alpha} demonstrated that intratracheal aerosolization with glucan phosphate successfully blocked the dectin-1 receptors on alveolar macrophages in vivo (Figures 7A–7C). Thus it appears that although the dectin-1 receptor (at least on alveolar macrophages) can be inhibited by glucan phosphate, inhibition of the dectin-1 receptor has little effect on the in vivo inflammatory response in the lung, suggesting that dectin-1 is not required.


Figure 7
View larger version (10K):
[in this window]
[in a new window]

 
Figure 7. Inhibition of dectin-1 receptor on alveolar macrophages in vivo in the lung by glucan phosphate aerosolization. Glucan phosphate (GP) (400 µg in 100 µl) or saline control were administered by intratracheal aerosolization to C57BL/6 mice, and 24 hours later the alveolar macrophages were harvested for culture. Subsequently the macrophages were stimulated with zymosan (100 µg/ml; shaded bars) in vitro or with saline as control (open bars). RNA extracted from the cells was reverse-transcribed and underwent real-time quantitative (Taqman) PCR for IL-6, IL-1β, and TNF-{alpha} gene expression (A–C) with GAPDH as control. Prior aerosolization with glucan phosphate resulted in significant suppression of IL-6, IL-1β, and TNF-{alpha} gene expression and therefore was able to block the dectin-1 receptor on alveolar macrophages. Data were reproducible in three independent experiments. *P < 0.05.

 
The In Vivo Pulmonary Inflammatory Response to Zymosan Is Not Reduced by Dectin-1 Inhibition, Despite the Absence of TLR2 or Complement
Since there is evidence that the response to zymosan may be increased by collaboration of the dectin-1 receptor with TLR2 (21, 22, 34, 38, 40), we evaluated the inflammatory response to zymosan in TLR2-deficient mice with dectin-1 inhibition. We also looked at the effect of dectin-1 inhibition in C3-deficient mice. Zymosan was administered, with or without s-dectin-hFc, by intratracheal aerosolization to C57BL/6, TLR2-deficient, and C3-deficient mice. There was no difference in the neutrophil response to zymosan between the different strains of mice regardless of dectin-1 inhibition (Figures 8A and 8B). The marked release of TNF-{alpha} into the BAL fluid in response to aerosolized zymosan was similarly unaltered (Figure 8C). These findings indicate a lack of a collaborative response to zymosan by the dectin-1 receptor and TLR2 or complement.


Figure 8
View larger version (16K):
[in this window]
[in a new window]

 
Figure 8. In vivo pulmonary neutrophil response to zymosan not affected by dectin-1 inhibition with or without TLR2 or complement. Zymosan (100 µg) was administered by intratracheal aerosolization to C57BL/6, TLR2-deficient, and C3-deficient mice alone (shaded bars) or with s-dectin-hFc (1 µg; solid bars) in a total volume of 100 µl. The zymosan was incubated with the s-dectin-hFc for 1 hour at 4°C before aerosolization. BAL fluid was harvested 24 hours after challenge. (A) Percentage neutrophils, (B) total neutrophils, and (C) TNF-{alpha} concentration in the BAL fluid are illustrated. The inflammatory response to zymosan was not inhibited in the absence of TLR2 or complement and dectin-1 blockade (n = 3–4 /group). NS = no significant difference.

 
The In Vivo Pulmonary Inflammatory Response to Zymosan Is Not Affected by Depletion of Alveolar Macrophages
Our observation that dectin-1 inhibition in the lung in vivo had no effect on the inflammatory response to zymosan (Figure 5), despite being able to inhibit the in vitro response in alveolar macrophages (Figure 6), suggests that the alveolar macrophage itself may not be required for this response. We therefore selectively depleted the alveolar macrophage population using the well-validated method of intrapulmonary delivery of clodronate liposomes (46). It has been demonstrated that a single dose of clodronate liposomes depletes 75 to 90% of alveolar macrophages (58), and therefore this method has been used extensively to deplete these cells in the lung (5963). Alveolar macrophages selectively phagocytose the liposomes, and the released clodronate chelates intracellular calcium, resulting in apoptotic death of the cell. Clodronate released from dead macrophages does not affect nonphagocytic cells and has an extremely short half-life. We administered zymosan by intratracheal aerosolization 2 days after intratracheal clodronate liposomes as recommended (46), and then harvested the mice 24 hours later. By 2 days after administration of clodronate liposomes, the numbers of alveolar macrophages were 38.5 x 103 (3.2) (mean [SEM]), compared with 2 days after administration of saline control, 190 x 103 (19.3); thus, there was an overall reduction in alveolar macrophages of 78.5% (Figure 9A). The administration of clodronate liposomes produced a small rise in neutrophils 2 days after administration, although this was not significantly different from control (Figure 9B), and there was no significant increase in TNF-{alpha} (Figure 9C). Despite the depletion of the majority of the alveolar macrophages in the mice given clodronate liposomes, a robust neutrophil response to zymosan was seen, equivalent to that seen in mice without alveolar macrophage depletion (Figure 9B). Although the release of TNF-{alpha} was reduced in macrophage-depleted mice, we were unable to detect a significant difference (Figure 9C). Although the depletion of alveolar macrophages was not complete, these results suggest that they are not the dominant cell required for the inflammatory response to zymosan.


Figure 9
View larger version (14K):
[in this window]
[in a new window]

 
Figure 9. In vivo pulmonary inflammatory response to zymosan not affected by depletion of alveolar macrophages The alveolar macrophage population in C57BL/6 mice was selectively depleted by intratracheal aerosolization of 100 µl of clodronate liposomes. In the controls, the mice were harvested 2 days after administration of saline/clodronate liposomes, and BAL fluid alveolar macrophages had decreased from 190 x 10–3 (19.3) (mean [SEM]) in the saline controls to 38.5 x 10–3 (3.2) in the mice given clodronate liposomes (left side of A), a depletion of 78.5% of alveolar macrophages. The administration of clodronate liposomes resulted in a slight increase in BAL neutrophils, which was not, however, significantly different from that of the control (left side of B). In addition, there was no increase in TNF-{alpha} in the BAL fluid compared with controls (left side of C). In another group of mice similarly treated with saline/clodronate liposomes for 48 hours, saline or zymosan (100 µg) was administered by intratracheal aerosolization and the BAL fluid harvested 24 hours later. Despite the depletion of the majority of the alveolar macrophages in BAL fluid, there was no reduction in neutrophil influx (right side of B), or in released TNF-{alpha} (C) in response to zymosan. These results suggest that alveolar macrophages are not required for the inflammatory response to zymosan (n = 3/group). Shaded bars, zymosan; open bars, control. NS = no significant difference; **P < 0.05.

 

    DISCUSSION
 Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 
This is the first report, to our knowledge, that examines the innate immune response to zymosan in the mouse lung, despite the fact that this is the commonest site of infection in immunocompromised individuals. The intrapulmonary administration of zymosan results in markedly increased neutrophil counts, with a maximal influx between 6 and 48 hours, accompanied by cytokine and chemokine release in BAL fluid (Figure 2). The maximal release of TNF-{alpha}, MIP-1{alpha}, KC, and IL-6 occurred within the first 24 hours, which is in keeping with their known neutrophil chemoattractant effects (6467). The release of MCP-1, in contrast, was maximal after 24 hours but within 4 days, and may play a role in the sustained increase in neutrophils over this time period, since MCP-1, as well as recruiting mononuclear cells, can act a neutrophil chemoattractant (68). Previously published studies have variously concluded that TLR2 (27, 2931, 41) or the dectin-1 receptor (32, 33), or both (21, 22), are required for optimal inflammatory response to zymosan in vitro, or into the peritoneum. There is also evidence that complement plays a role in this response (2325). In vitro experiments conducted by us provided evidence that the dominant receptor on primary alveolar macrophages responsible for the response to zymosan is the dectin-1 receptor (Figure 6), and therefore these experiments are not at odds with previous publications. Moreover, we have previously found a role for TLR2 and C5a in the innate immune response to zymosan in the peritoneum (69), suggesting that the innate immune response to zymosan in the lung is unique.

Our aim was to examine which receptors are necessary for leukocyte recruitment to the lung in response to zymosan in vivo. Surprisingly, we found that the pulmonary inflammatory response to zymosan was not reduced in TLR2- or complement-deficient mice (Figure 4, Table 1, and Figure E3) or if dectin-1 was inhibited (Figure 5) even in the absence of TLR2 or complement (Figure 8). We observed a robust inflammatory response to zymosan in TLR2-deficient mice that was in sharp contrast to their poor response to specific TLR2 agonists (Figure 4), suggesting that although a TLR2 detection mechanism exists in the lung, it is not important for the response to zymosan. Mice lacking TLR4 or MyD88 also had a similar marked inflammatory response to zymosan (Table 1), eliminating a potential role for most TLRs. Measurements of cytokines and chemokines in the different mouse strains showed very little difference in their response to zymosan, at the 6- or 24-hour time points (Table 1, Figures E2 and E3).

Since the dectin-1 receptor is regarded as being the dominant receptor with regard to fungal β-glucans, we attempted to inhibit this receptor in vivo by three different methods: (1) laminarin, (2) a soluble fusion dectin protein (s-dectin-hFc), and (3) purified glucan phosphate. s-dectin-hFc and glucan phosphate were able to inhibit the inflammatory response to zymosan in vitro (Figure 6). Laminarin was unable to block dectin-1 in vitro and this may be due to a combination of its low binding affinity for the dectin-1 receptor (53), and the fact that the receptor is able to recycle to the cell surface after laminarin exposure (54). Another publication has also noted that laminarin fails to block the response to zymosan (70). Purified glucan phosphate markedly reduces dectin-1 receptors on leukocytes for several days, and we demonstrated that we were able to block the dectin-1 receptor on alveolar macrophages for at least 24 hours. Despite being able to inhibit the dectin-1 receptor in vivo in the mouse lung with s-dectin-hFc or glucan phosphate, the pulmonary response to zymosan was unaffected. In addition, blocking dectin-1 in TLR2- or complement-deficient mice had no detectable effect on the response, suggesting that collaboration between these receptors is not required in the lung as previously reported in vitro or in other tissues (21, 34, 38, 40).

These unexpected results forced us to consider the possibility that the alveolar macrophage itself may not be controlling the inflammatory response, despite the prevailing paradigm that this cell is the most important innate immune cell in the lung (5). We examined the strain of mouse reported to be deficient in macrophages (osteopetrotic [Op/Op]mice [71]), and found that these mice have numbers of alveolar macrophages similar to those of C57BL/6 mice (data not shown). These mice have also been reported to spontaneously correct their alveolar macrophage deficiency spontaneously with age (72); therefore, we elected to use clodronate liposomes to selectively deplete alveolar macrophages instead (5863). We were able to deplete alveolar macrophages by an average of 78.5%, and observed that the neutrophil and TNF-{alpha} response to intratracheal aerosolized zymosan was unaffected. It is possible that the small number of macrophages remaining in the lungs might be sufficient for maximal inflammatory response to zymosan. Interestingly, other studies using clodronate liposome depletion of alveolar macrophages have shown variable results, concluding that the alveolar macrophage either suppresses or enhances the response to different pathogens (5860, 62). Taken together, the failure of dectin-1 inhibition or selective depletion of the majority of alveolar macrophages to inhibit the in vivo inflammatory response to zymosan, suggests that the alveolar macrophage is not the principle cell responsible for detecting zymosan in the lung in vivo. This would explain, at least partially, the discordant in vitro and in vivo results in the literature.

Other in vivo studies in mice have delivered zymosan into the peritoneum (33, 70, 73), pleural space (74), and the joint space (31). In one study, the inflammatory response to intra-articular injection of zymosan in a murine model of arthritis was partially dependent on TLR2 (31), while another study demonstrated an important role for both TLR2 and dectin-1 in triggering arthritis after intraperitoneal zymosan injection (70). Although different preparations and/or handling of zymosan or different environments could perhaps account for differences in response, neutrophil recruitment into the peritoneum in response to the same stock of zymosan in mice housed in the same facility resulted in a maximum response of neutrophil recruitment at 4 hours (dropping significantly by 24 h), dependent almost entirely on mast cell C5aR (73). Strikingly, in the lung, the neutrophil influx in response to zymosan at 6 hours was less than that at 24 hours. In addition, the lung zymosan response had no complement or mast cell (data not shown) dependency, suggesting very different responses between the peritoneum and lung. We also used the same source and similar doses of zymosan (100 µg/mouse) as used in other in vivo studies (100–180 µg/mouse [31, 73, 74]), and therefore conclude that organ specificity rather than dose or source of zymosan can account for the differences between these studies and ours.

Clearly, zymosan induces a very different innate immune response in the lung, independent of dectin-1 and complement, to that in the pleural space (74) and peritoneum (33, 73). Although a brisk inflammatory response in the peritoneal, pleural, or joint space would not initially have much effect on the vital functions of the organism, a marked influx of inflammatory cells into the lung whenever a foreign particle is encountered has the potential to disrupt the delicate alveolar membrane, resulting in gas exchange abnormalities. Indeed, the lung uses unique ways to dampen the inflammatory response, producing prolonged release of indoleamine 2,3-dioxygenase, which inhibits trafficking of T cells into the lung in response to pulmonary administration of TLR ligands (75). In addition, alveolar macrophages are maintained in a constant state of inhibition by TGF-β bound to {alpha}vβ6 integrin on the surface of alveolar epithelial cells (76), and repression of {alpha}vβ6 integrin expression is required to overcome this tonic inhibition. This tight control over the pulmonary innate immune system, and specifically the alveolar macrophage, suggests that some other cell type(s) might be responsible for inducing inflammatory responses to zymosan and, by inference, to fungal pathogens.

Although zymosan is composed of approximately 55% β-glucans and 20% mannans by weight (77), it is unlikely that the mannan component is necessary for the pulmonary inflammatory response, since the recognition of mannoprotein is dependent on MyD88 and TLR4 (78, 79). The β-glucan component of fungal walls is considered to be the main component driving the response to fungal organisms (8082), and there is evidence that alveolar epithelial cells (83), endothelial cells (8), and fibroblasts (6) can respond to β-glucans with up-regulation of inflammatory response genes. Alveolar epithelial cells lack the dectin-1 receptor and instead have been shown to be able to bind β-glucan derived from the cell wall of S. cerevisiae via the lactosylceramide receptor (84).

Finally, redundancy is a common feature of inflammation, and so it is possible that the absence of only dectin-1 or only TLR2 was insufficient to prevent activation of the innate immune system. However, our data would suggest that it is very unlikely that dectin-1 and TLR2 were compensating for each other, since tandem inhibition of both molecules did not prevent the recruitment response. Nevertheless, it is important to remember that multiple pathways have evolved to deal with infections, and genetic targeting of one pathway can increase the importance of another pathway. Although we were unable to demonstrate this type of redundancy with the dectin-1, C5a, or TLR2 receptors, our approach in this regard was not exhaustive.

In conclusion, we have shown that the inflammatory response of the lung in vivo to locally administered zymosan is independent of the TLR2 and the dectin-1 receptor, and at least partially independent of the alveolar macrophage. This study highlights the importance of testing hypotheses generated by in vitro studies in an in vivo model.


    Acknowledgments
 
The authors thank Bryan Heit for his help with the fluorescent microphotograph, and Caroline Leger, who performed the Luminex cytokine/chemokine assays.


    Footnotes
 
M.M.K. is a Canadian Institutes for Health Research Fellow. P.K. is an Alberta Heritage Foundation for Medical Research Scientist, the Snyder Chair in Critical Care Medicine, and a Canada Research Chair at the University of Calgary.

This article has an online supplement, which is accessible from this issue's table of contents at www.atsjournals.org

Originally Published in Press as DOI: 10.1165/rcmb.2007-0045OC on August 23, 2007

Conflict of Interest Statement: None of the authors has a financial relationship with a commercial entity that has an interest in the subject of this manuscript.

Received in original form February 13, 2007

Accepted in final form June 14, 2007


    References
 Top
 Abstract
 CLINICAL RELEVANCE
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 References
 

  1. Filler SG, Yeaman MR, Sheppard DC. Tumor necrosis factor inhibition and invasive fungal infections. Clin Infect Dis 2005;41:S208–S212.[CrossRef][Medline]
  2. Thomas CF Jr, Limper AH. Pneumocystis pneumonia. N Engl J Med 2004;350:2487–2498.[Free Full Text]
  3. Romani L. Immunity to fungal infections. Nat Rev Immunol 2004;4:1–23.[CrossRef][Medline]
  4. Hohl TM, Rivera A, Pamer EG. Immunity to fungi. Curr Opin Immunol 2006;18:465–472.[CrossRef][Medline]
  5. Lohmann-Matthes ML, Steinmuller C, Franke-Ullmann G. Pulmonary macrophages. Eur Respir J 1994;7:1678–1689.[Abstract]
  6. Kougias P, Wei D, Rice PJ, Ensley HE, Kalbfleisch J, Williams DL, Browder IW. Normal human fibroblasts express pattern recognition receptors for fungal (1->3)-beta-D-glucans. Infect Immun 2001;69:3933–3938.[Abstract/Free Full Text]
  7. Supajatura V, Ushio H, Nakao A, Akira S, Okumura K, Ra C, Ogawa H. Differential responses of mast cell Toll-like receptors 2 and 4 in allergy and innate immunity. J Clin Invest 2002;109:1351–1359.[CrossRef][Medline]
  8. Lowe EP, Wei D, Rice PJ, Li C, Kalbfleisch J, Browder IW, Williams DL. Human vascular endothelial cells express pattern recognition receptors for fungal glucans which stimulates nuclear factor kappaB activation and interleukin 8 production. Am Surg 2002;68:508–517.[Medline]
  9. Armstrong L, Medford AR, Uppington KM, Robertson J, Witherden IR, Tetley TD, Millar AB. Expression of functional toll-like receptor-2 and -4 on alveolar epithelial cells. Am J Respir Cell Mol Biol 2004;31:241–245.[Abstract/Free Full Text]
  10. Guillot L, Medjane S, Le Barillec K, Balloy V, Danel C, Chignard M, Si-Tahar M. Response of human pulmonary epithelial cells to lipopolysaccharide involves Toll-like receptor 4 (TLR4)-dependent signaling pathways: evidence for an intracellular compartmentalization of TLR4. J Biol Chem 2004;279:2712–2718.[Abstract/Free Full Text]
  11. Martin TR, Frevert CW. Innate immunity in the lungs. Proc Am Thorac Soc 2005;2:403–411.[Abstract/Free Full Text]
  12. Aderem A, Ulevitch RJ. Toll-like receptors in the induction of the innate immune response. Nature 2000;406:782–787.[CrossRef][Medline]
  13. Akira S, Takeda K, Kaisho T. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat Immunol 2001;2:675–680.[CrossRef][Medline]
  14. Janeway CA Jr, Medzhitov R. Innate immune recognition. Annu Rev Immunol 2002;20:197–216.[CrossRef][Medline]
  15. Van Kooyk Y, Geijtenbeek TB. DC-SIGN: escape mechanism for pathogens. Nat Rev Immunol 2003;3:697–709.[CrossRef][Medline]
  16. Cambi A, Figdor CG. Levels of complexity in pathogen recognition by C-type lectins. Curr Opin Immunol 2005;17:345–351.[CrossRef][Medline]
  17. Taylor PR, Brown GD, Reid DM, Willment JA, Martinez-Pomares L, Gordon S, Wong SY. The beta-glucan receptor, dectin-1, is predominantly expressed on the surface of cells of the monocyte/macrophage and neutrophil lineages. J Immunol 2002;169:3876–3882.[Abstract/Free Full Text]
  18. Steele C, Marrero L, Swain S, Harmsen AG, Zheng M, Brown GD, Gordon S, Shellito JE, Kolls JK. Alveolar macrophage-mediated killing of Pneumocystis carinii f. sp. muris involves molecular recognition by the Dectin-1 beta-glucan receptor. J Exp Med 2003;198:1677–1688.[Abstract/Free Full Text]
  19. Olynych TJ, Jakeman DL, Marshall JS. Fungal zymosan induces leukotriene production by human mast cells through a dectin-1-dependent mechanism. J Allergy Clin Immunol 2006;118:837–843.[CrossRef][Medline]
  20. Medzhitov R, Preston-Hurlburt P, Kopp E, Stadlen A, Chen C, Ghosh S, Janeway CA Jr. MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways. Mol Cell 1998;2:253–258.[CrossRef][Medline]
  21. Gantner BN, Simmons RM, Canavera SJ, Akira S, Underhill DM. Collaborative induction of inflammatory responses by dectin-1 and Toll-like receptor 2. J Exp Med 2003;197:1107–1117.[Abstract/Free Full Text]
  22. Brown GD, Herre J, Williams DL, Willment JA, Marshall AS, Gordon S. Dectin-1 mediates the biological effects of beta-glucans. J Exp Med 2003;197:1119–1124.[Abstract/Free Full Text]
  23. Fearon DT, Austen KF. Activation of the alternative complement pathway due to resistance of zymosan-bound. Proc Natl Acad Sci USA 1977;74:1683–1687.[Abstract/Free Full Text]
  24. Stahl GL, Fletcher MP, Amsterdam EA, Longhurst JC. Role of granulocytes and C5a in myocardial response to zymosan-activated serum. Am J Physiol 1991;261:H29–H37.[Medline]
  25. Guo RF, Ward PA. Role of C5a in inflammatory responses. Annu Rev Immunol 2005;23:821–852.[CrossRef][Medline]
  26. Guo RF, Riedemann NC, Laudes IJ, Sarma VJ, Kunkel RG, Dilley KA, Paulauskis JD, Ward PA. Altered neutrophil trafficking during sepsis. J Immunol 2002;169:307–314.[Abstract/Free Full Text]
  27. Underhill DM, Ozinsky A, Hajjar AM, Stevens A, Wilson CB, Bassetti M, Aderem A. The Toll-like receptor 2 is recruited to macrophage phagosomes and discriminates between pathogens. Nature 1999;401:811–815.[CrossRef][Medline]
  28. Underhill DM. Macrophage recognition of zymosan particles. J Endotoxin Res 2003;9:176–180.[Medline]
  29. Ozinsky A, Underhill DM, Fontenot JD, Hajjar AM, Smith KD, Wilson CB, Schroeder L, Aderem A. The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between toll-like receptors. Proc Natl Acad Sci USA 2000;97:13766–13771.[Abstract/Free Full Text]
  30. Sato M, Sano H, Iwaki D, Kudo K, Konishi M, Takahashi H, Takahashi T, Imaizumi H, Asai Y, Kuroki Y. Direct binding of Toll-like receptor 2 to zymosan, and zymosan-induced NF-kappa B activation and TNF-alpha secretion are down-regulated by lung collectin surfactant protein A. J Immunol 2003;171:417–425.[Abstract/Free Full Text]
  31. Frasnelli ME, Tarussio D, Chobaz-Peclat V, Busso N, So A. TLR2 modulates inflammation in zymosan-induced arthritis in mice. Arthritis Res Ther 2005;7:R370–R379.[CrossRef][Medline]
  32. Gross O, Gewies A, Finger K, Schafer M, Sparwasser T, Peschel C, Forster I, Ruland J. Card9 controls a non-TLR signalling pathway for innate anti-fungal immunity. Nature 2006;442:651–656.[CrossRef][Medline]
  33. Taylor PR, Tsoni SV, Willment JA, Dennehy KM, Rosas M, Findon H, Haynes K, Steele C, Botto M, Gordon S, et al. Dectin-1 is required for beta-glucan recognition and control of fungal infection. Nat Immunol 2007;8:31–38.[CrossRef][Medline]
  34. Steele C, Rapaka RR, Metz A, Pop SM, Williams DL, Gordon S, Kolls JK, Brown GD. The beta-glucan receptor dectin-1 recognizes specific morphologies of Aspergillus fumigatus. PLoS Pathog 2005;1:e42.[Medline]
  35. Hohl TM, Van Epps HL, Rivera A, Morgan LA, Chen PL, Feldmesser M, Pamer EG. Aspergillus fumigatus triggers inflammatory responses by stage-specific beta-glucan display. PLoS Pathog 2005;1:e30.[Medline]
  36. Gantner BN, Simmons RM, Underhill DM. Dectin-1 mediates macrophage recognition of Candida albicans yeast but not filaments. EMBO J 2005;24:1277–1286.[CrossRef][Medline]
  37. Viriyakosol S, Fierer J, Brown GD, Kirkland TN. Innate immunity to the pathogenic fungus Coccidioides posadasii is dependent on Toll-like receptor 2 and Dectin-1. Infect Immun 2005;73:1553–1560.[Abstract/Free Full Text]
  38. Gersuk GM, Underhill DM, Zhu L, Marr KA. Dectin-1 and TLRs permit macrophages to distinguish between different Aspergillus fumigatus cellular states. J Immunol 2006;176:3717–3724.[Abstract/Free Full Text]
  39. Rogers NC, Slack EC, Edwards AD, Nolte MA, Schulz O, Schweighoffer E, Williams DL, Gordon S, Tybulewicz VL, Brown GD, et al. Syk-dependent cytokine induction by Dectin-1 reveals a novel pattern recognition pathway for C type lectins. Immunity 2005;22:507–517.[CrossRef][Medline]
  40. Suram S, Brown GD, Ghosh M, Gordon S, Loper R, Taylor PR, Akira S, Uematsu S, Williams DL, Leslie CC. Regulation of cytosolic phospholipase A2 activation and cyclooxygenase 2 expression in macrophages by the beta-glucan receptor. J Biol Chem 2006;281:5506–5514.[Abstract/Free Full Text]
  41. Saijo S, Fujikado N, Furuta T, Chung SH, Kotaki H, Seki K, Sudo K, Akira S, Adachi Y, Ohno N, et al. Dectin-1 is required for host defense against Pneumocystis carinii but not against Candida albicans. Nat Immunol 2007;8:39–46.[CrossRef][Medline]
  42. Kelly MM, Brown G, Maxwell L, Gwozd C, Williams DL, Mody CH, Kubes P. Pulmonary innate immune response to zymosan. Am J Respir Crit Care Med 2007;175:A482.
  43. Kelly MM, Gwozd C, Mody CH, Kubes P. The inflammatory response to zymosan in the lung is TLR-2 independent. Am J Respir Crit Care Med 2006;3:A322.
  44. Ettinger R, Browning JL, Michie SA, van Ewijk W, McDevitt HO. Disrupted splenic architecture, but normal lymph node development in mice expressing a soluble lymphotoxin-beta receptor-IgG1 fusion protein. Proc Natl Acad Sci USA 1996;93:13102–13107.[Abstract/Free Full Text]
  45. Williams DL, McNamee RB, Jones EL, Pretus HA, Ensley HE, Browder IW, Di Luzio NR. A method for the solubilization of a (1—-3)-beta-D-glucan isolated from Saccharomyces cerevisiae. Carbohydr Res 1991;219:203–213.[CrossRef][Medline]
  46. van Rooijen N, Sanders A. Liposome mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications. J Immunol Methods 1994;174:83–93.[CrossRef][Medline]
  47. Young SH, Robinson VA, Barger M, Porter DW, Frazer DG, Castranova V. Acute inflammation and recovery in rats after intratracheal instillation of a 1->3-beta-glucan (zymosan A). J Toxicol Environ Health A 2001;64:311–325.[CrossRef][Medline]
  48. Maus UA, Wellmann S, Hampl C, Kuziel WA, Srivastava M, Mack M, Everhart MB, Blackwell TS, Christman JW, Schlondorff D, et al. CCR2-positive monocytes recruited to inflamed lungs downregulate local CCL2 chemokine levels. Am J Physiol Lung Cell Mol Physiol 2005;288:L350–L358.[Abstract/Free Full Text]
  49. Kelly MM, Leigh R, Bonniaud P, Ellis R, Wattie J, Smith MJ, Martin G, Panju M, Inman MD, Gauldie J. Epithelial expression of profibrotic mediators in a model of allergen-induced airway remodeling. Am J Respir Cell Mol Biol 2005;32:99–107.[Abstract/Free Full Text]
  50. Huber-Lang M, Sarma JV, Zetoune FS, Rittirsch D, Neff TA, McGuire SR, Lambris JD, Warner RL, Flierl MA, Hoesel LM, et al. Generation of C5a in the absence of C3: a new complement activation pathway. Nat Med 2006;12:682–687.[CrossRef][Medline]
  51. Colten HR, Ooi YM, Edelson PJ. Synthesis and secretion of complement proteins by macrophages. Ann NY Acad Sci. 1979;332:482–490.[CrossRef][Medline]
  52. Brown GD, Gordon S. Immune recognition. A new receptor for beta-glucans. Nature 2001;413:36–37.[Medline]
  53. Graham LM, Tsoni SV, Willment JA, Williams DL, Taylor PR, Gordon S, Dennehy K, Brown GD. Soluble Dectin-1 as a tool to detect beta-glucans. J Immunol Methods 2006;314:164–169.[CrossRef][Medline]
  54. Herre J, Marshall AS, Caron E, Edwards AD, Williams DL, Schweighoffer E, Tybulewicz V, Reis e Sousa C, Gordon S, Brown GD. Dectin-1 uses novel mechanisms for yeast phagocytosis in macrophages. Blood 2004;104:4038–4045.[Abstract/Free Full Text]
  55. Brown GD, Taylor PR, Reid DM, Willment JA, Williams DL, Martinez-Pomares L, Wong SY, Gordon S. Dectin-1 is a major beta-glucan receptor on macrophages. J Exp Med 2002;196:407–412.[Abstract/Free Full Text]
  56. Ozment-Skelton TR, Goldman MP, Gordon S, Brown GD, Williams DL. Prolonged reduction of leukocyte membrane-associated Dectin-1 levels following beta-glucan administration. J Pharmacol Exp Ther 2006;318:540–546.[Abstract/Free Full Text]
  57. Herre J, Gordon S, Brown GD. Dectin-1 and its role in the recognition of beta-glucans by macrophages. Mol Immunol 2004;40:869–876.[CrossRef][Medline]
  58. Thepen T, van Rooijen N, Kraal G. Alveolar macrophage elimination in vivo is associated with an increase in pulmonary immune response in mice. J Exp Med 1989;170:499–509.[Abstract/Free Full Text]
  59. Leemans JC, Juffermans NP, Florquin S, van Rooijen N, Vervoordeldonk MJ, Verbon A, van Deventer SJ, van der Poll T. Depletion of alveolar macrophages exerts protective effects in pulmonary tuberculosis in mice. J Immunol 2001;166:4604–4611.[Abstract/Free Full Text]
  60. Kradin RL, Liu HW, van Rooijen N, Springer K, Zhao LH, Leary CP. Pulmonary immunity to Listeria is enhanced by elimination of alveolar macrophages. Am J Respir Crit Care Med 1999;159:1967–1974.[Abstract/Free Full Text]
  61. de Haan A, Groen G, Prop J, van Rooijen N, Wilschut J. Mucosal immunoadjuvant activity of liposomes: role of alveolar macrophages. Immunology 1996;89:488–493.[CrossRef][Medline]
  62. Limper AH, Hoyte JS, Standing JE. The role of alveolar macrophages in Pneumocystis carinii degradation and clearance from the lung. J Clin Invest 1997;99:2110–2117.[Medline]
  63. Maus UA, Koay MA, Delbeck T, Mack M, Ermert M, Ermert L, Blackwell TS, Christman JW, Schlondorff D, Seeger W, et al. Role of resident alveolar macrophages in leukocyte traffic into the alveolar air space of intact mice. Am J Physiol Lung Cell Mol Physiol 2002;282:L1245–L1252.[Abstract/Free Full Text]
  64. Ramos CD, Canetti C, Souto JT, Silva JS, Hogaboam CM, Ferreira SH, Cunha FQ. MIP-1alpha[CCL3] acting on the CCR1 receptor mediates neutrophil migration in immune inflammation via sequential release of TNF-alpha and LTB4. J Leukoc Biol 2005;78:167–177.[Abstract/Free Full Text]
  65. Alcamo E, Mizgerd JP, Horwitz BH, Bronson R, Beg AA, Scott M, Doerschuk CM, Hynes RO, Baltimore D. Targeted mutation of TNF receptor I rescues the RelA-deficient mouse and reveals a critical role for NF-kappa B in leukocyte recruitment. J Immunol 2001;167:1592–1600.[Abstract/Free Full Text]
  66. Olson TS, Ley K. Chemokines and chemokine receptors in leukocyte trafficking. Am J Physiol Regul Integr Comp Physiol 2002;283:R7–R28.[Abstract/Free Full Text]
  67. Reutershan J, Ley K. Bench-to-bedside review: acute respiratory distress syndrome - how neutrophils migrate into the lung. Crit Care 2004;8:453–461.[CrossRef][Medline]
  68. Johnston B, Burns AR, Suematsu M, Issekutz TB, Woodman RC, Kubes P. Chronic inflammation upregulates chemokine receptors and induces neutrophil migration to monocyte chemoattractant protein-1. J Clin Invest 1999;103:1269–1276.[Medline]
  69. Mullaly SC, Kubes P. The role of TLR2 in vivo following challenge with Staphylococcus aureus and prototypic ligands. J Immunol 2006;177:8154–8163.[Abstract/Free Full Text]
  70. Yoshitomi H, Sakaguchi N, Kobayashi K, Brown GD, Tagami T, Sakihama T, Hirota K, Tanaka S, Nomura T, Miki I, et al. A role for fungal {beta}-glucans and their receptor Dectin-1 in the induction of autoimmune arthritis in genetically susceptible mice. J Exp Med 2005;201:949–960.[Abstract/Free Full Text]
  71. Wiktor-Jedrzejczak W, Bartocci A, Ferrante AW Jr, Ahmed-Ansari A, Sell KW, Pollard JW, Stanley ER. Total absence of colony-stimulating factor 1 in the macrophage-deficient osteopetrotic (op/op) mouse. Proc Natl Acad Sci USA 1990;87:4828–4832.[Abstract/Free Full Text]
  72. Shibata Y, Zsengeller Z, Otake K, Palaniyar N, Trapnell BC. Alveolar macrophage deficiency in osteopetrotic mice deficient in macrophage colony-stimulating factor is spontaneously corrected with age and associated with matrix metalloproteinase expression and emphysema. Blood 2001;98:2845–2852.[Abstract/Free Full Text]
  73. Mullaly SC, Kubes P. Mast cell-expressed complement receptor, not TLR2, is the main detector of zymosan in peritonitis. Eur J Immunol 2007;37:224–234.[CrossRef][Medline]
  74. Takeshita K, Sakai K, Bacon KB, Gantner F. Critical role of histamine H4 receptor in leukotriene B4 production and mast cell-dependent neutrophil recruitment induced by zymosan in vivo. J Pharmacol Exp Ther 2003;307:1072–1078.[Abstract/Free Full Text]
  75. Hayashi T, Beck L, Rossetto C, Gong X, Takikawa O, Takabayashi K, Broide DH, Carson DA, Raz E. Inhibition of experimental asthma by indoleamine 2,3-dioxygenase. J Clin Invest 2004;114:270–279.[CrossRef][Medline]
  76. Takabayshi K, Corr M, Hayashi T, Redecke V, Beck L, Guiney D, Sheppard D, Raz E. Induction of a homeostatic circuit in lung tissue by microbial compounds. Immunity 2006;24:475–487.[CrossRef][Medline]
  77. Di Carlo FJ, Fiore JV. On the composition of zymosan. Science 1958;127:756–757.[Free Full Text]
  78. Netea MG, Gow NA, Munro CA, Bates S, Collins C, Ferwerda G, Hobson RP, Bertram G, Hughes HB, Jansen T, et al. Immune sensing of Candida albicans requires cooperative recognition of mannans and glucans by lectin and Toll-like receptors. J Clin Invest 2006;116:1642–1650.[CrossRef][Medline]
  79. Tada H, Nemoto E, Shimauchi H, Watanabe T, Mikami T, Matsumoto T, Ohno N, Tamura H, Shibata K, Akashi S, et al. Saccharomyces cerevisiae- and Candida albicans-derived mannan induced production of tumor necrosis factor alpha by human monocytes in a CD14- and Toll-like receptor 4-dependent manner. Microbiol Immunol 2002;46:503–512.[Medline]
  80. Vassallo R, Standing JE, Limper AH. Isolated Pneumocystis carinii cell wall glucan provokes lower respiratory tract inflammatory responses. J Immunol 2000;164:3755–3763.[Abstract/Free Full Text]
  81. Brown GD, Gordon S. Fungal beta-glucans and mammalian immunity. Immunity 2003;19:311–315.[CrossRef][Medline]
  82. Brown GD, Gordon S. Immune recognition of fungal beta-glucans. Cell Microbiol 2005;7:471–479.[CrossRef][Medline]
  83. Diamond G, Legarda D, Ryan LK. The innate immune response of the respiratory epithelium. Immunol Rev 2000;173:27–38.[CrossRef][Medline]
  84. Zimmerman JW, Lindermuth J, Fish PA, Palace GP, Stevenson TT, DeMong DE. A novel carbohydrate-glycosphingolipid interaction between a beta-(1-3)-glucan immunomodulator, PGG-glucan, and lactosylceramide of human leukocytes. J Biol Chem 1998;273:22014–22020.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supplement
Right arrow All Versions of this Article:
2007-0045OCv1
38/2/227    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kelly, M. M.
Right arrow Articles by Kubes, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kelly, M. M.
Right arrow Articles by Kubes, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Crit. Care Med.
Copyright © 2008 American Thoracic Society.