Published ahead of print on August 7, 2008, doi:10.1165/rcmb.2007-0377OC
American Journal of Respiratory Cell and Molecular Biology. Vol. 40, pp. 168-178, 2009
© 2009 American Thoracic Society DOI: 10.1165/rcmb.2007-0377OC
Signal Pathway of 17β-Estradiol–Induced MUC5B Expression in Human Airway Epithelial Cells
Hye Joung Choi1,*,
Yoo-Sam Chung5,*,
Hyun Jik Kim6,
Uk Yeol Moon1,3,
Yeon Ho Choi1,3,
Isabelle Van Seuningen7,
Seung Joon Baek8,
Ho-Geun Yoon4 and
Joo-Heon Yoon1,2,3
1 Department of Otorhinolaryngology, 2 The Airway Mucus Institute, 3 BK21 Project for Medical Science, 4 Department of Biochemistry and Molecular Biology, Yonsei University College of Medicine, Seoul, Korea; 5 Department of Otolaryngology, Asan Medical Center, College of Medicine, University of Ulsan, Seoul, Korea; 6 Department of Otolaryngology–Head and Neck Surgery, Chung-Ang University College of Medicine, Seoul, Korea; 7 The Unite INSERM 560, Place de Verdun, Lille, France; and 8 Department of Pathobiology, University of Tennessee, College of Veterinary Medicine, Knoxville, Tennessee
Correspondence and requests for reprints should be addressed to Joo-Heon Yoon, M.D., Department of Otorhinolaryngology, Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemun-gu, Seoul, Korea 120-752. E-mail: jhyoon{at}yuhs.ac
 |
Abstract
|
|---|
MUC5B is a major mucin of the human respiratory tract, and it is not clear how MUC5B expression is regulated in various airway diseases. The goal of this study was to determine the mechanisms by which 17β-estradiol induces MUC5B gene expression in airway epithelial cells. It was found that E2, a sex hormone, stimulates MUC5B gene overexpression by interaction with estrogen receptor (ER ) and by acting through extracellular signal–regulated kinase 1/2 (ERK1/2)-mitogen-activated protein kinase (MAPK). Pretreatment with ER antagonist ICI 182,780 blocked both E2-induced ERK1/2-MAPK activation and MUC5B gene expression. It was also found that the activation of p90 ribosomal S 6 protein kinase 1 (RSK1), cAMP-response element-binding protein (CREB), and cAMP-response element (CRE) (–956 region of the MUC5B promoter)-responsive signaling cascades via ERK1/2 MAPK are crucial aspects of the intracellular mechanisms that mediate MUC5B gene expression. Taken together, these studies give additional insights into the molecular mechanism of hormone-induced MUC5B gene expression and enhance our understanding of abnormal mucin secretion in response to hormonal imbalances.
Key Words: MUC5B estrogen ER CREB
 |
CLINICAL RELEVANCE
|
|---|
These studies give additional insights into the molecular mechanism of hormone-induced MUC5B gene expression and enhance our understanding of abnormal mucin secretion in response to hormonal imbalances.
| Mechanicochemical proteins produced by airway epithelial cells are essential components of airway mucus, which plays an important role in protecting the airway from bacterial and viral attacks. Mucin hypersecretion is commonly observed in many respiratory diseases, such as rhinitis, sinusitis, otitis media, nasal allergy, chronic bronchitis, and cystic fibrosis (1–5). To date, twenty distinct mucin genes have been identified: MUC1–4, MUC5AC, MUC5B, MUC6–9, MUC11–13, and MUC15–20 (6–23). Of these, MUC5AC and MUC5B have been shown to be major components of respiratory secretions. Expression of such mucin genes is increased by inflammatory mediators, such as LPS (24), TNF- (25), IL-1 (25), IL-17 (26), and β neutrophil elastase (NE) (27). In addition to such inflammatory mediators, it is known that the sex hormone estrogen also induces glandular hyperplasia and increases mucus in the nasal mucosa (28, 29).
MUC5B is one of the major mucins in the human airway submucosal glands (30). In chronic airway diseases, such as cystic fibrosis and chronic sinusitis, increases in mucin secretion could be achieved through marked enlargement of the submucosal glands, accompanied by increases in the number of cells involved in MUC5B synthesis. There are some postmeopausal women who complain of nasal or throat dryness. However, the reason for these symptoms remains unclear. Since the decrease of estrogen level in postmenopausal period suppresses MUC5B gene expression, which in turn induces vaginal dryness (31), we thought that symptoms of nasal or throat dryness may be induced by the similar mechanisms. In preliminary studies, we found that MUC5B gene expression is increased by E2 in normal human nasal epithelial cells. In this study, we sought to elucidate the mechanisms by which E2 induces MUC5B gene expression.
Many estrogenic actions are mediated by intracellular estrogen receptors (ERs) that function as ligand-activated transcription factors to regulate the expression of estrogen-responsive genes (32). E2 rapidly activates adenylate cyclase, increasing intracellular levels of active phospholipase C to generate inositol 1,4,5-triphosphate and diacylglycerol, stimulating nitric oxide synthase to generate nitric oxide and activating the extracellular signal–regulated kinase 1/2 (ERK1/2) mitogen-activated protein kinase (MAPK) pathway (33–35). The molecular mechanisms of these rapid membrane-initiated actions are not fully understood.
The goal of this study was to elucidate details of the mechanism by which E2 induces MUC5B gene expression in airway epithelial cells. This study revealed that ERK1/2-MAPK was essential for E2-induced MUC5B gene expression in human airway epithelial cells, and that p90 ribosomal S 6 protein kinase 1 (RSK1) mediated the E2-induced phosphorylation of the cAMP response element (CRE)-binding (CREB) protein. In addition, the transcription activities of MUC5B promoter regions showed that the CRE in the MUC5B promoter is important for E2-induced MUC5B gene expression.
 |
MATERIALS AND METHODS
|
|---|
Materials
ICI 182,780 was obtained from Tocris (Ellisville, MO). PD98059 and anti– -tubulin antibody were purchased from Calbiochem (San Diego, CA). Anti–phospho p44/42 MAPK (Thr-202/Tyr-204, p-ERK1/2), anti-p44/42 MAPK (ERK1/2), anti–phospho-p38 MAPK (Thr-180/Tyr-182), anti–phospho-SAPK/c-Jun NH2-terminal kinase MAPK (Thr-183/Tyr-185), anti–phospho-RSK1 (Ser-380), anti-RSK1/2/3, anti–phospho-CREB (Ser-133), anti-CREB, and anti–phospho-ER (Ser-118) antibodies were purchased from Cell Signaling Technology (Beverly, MA). Anti-MUC5B antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
Plasmid Constructions
The MUC5B-pGL3 deletion mutants covering promoter regions of MUC5B were generated by PCR using pairs of primers bearing specific restriction sites. 5' deletion mutants of different sizes (–1329, –956, and –649 bp) that all begin at +92 of MUC5B gene were obtained from MUC5B-pGL3 construct deletion mutants. –1329/+92 PF (5'-CACGTCTCTGCCAACACTTCC-3'), –956/+92 PF (5'-GAGGTATTGCAGCGCGGACG-3'), and –649/+92 PF (5'-AGCTGACTCCCGATGTGCAT-3') with MluI site at 5' end and PR (5'-CTCGAGAACACCAGCGTCCGGCACGC-3') with XhoI site 5' end were used to amplify the 5' flanking region of MUC5B gene. The PCR was conducted at 94°C for 2 minutes followed by 35 cycles at 94°C for 30 seconds, 62°C for 30 seconds, 72°C for 30 seconds, and 72°C for 2 minutes. The PCR product was ligated into the pGEM–T Easy Vector (Promega, Madison, WI). The recombinant plasmid DNA was isolated and then cut with MluI (Promega) and XhoI (Promega) and cloned into the equivalent site of pGL3-basic vector (Promega) to construct three kinds of deletion mutants: pGL3–1329 bp, pGL3–956 bp, and pGL3–649 bp. All of them were sequenced.
To determine the location of the CREB response element on the 5'-flanking region of the MUC5B gene, three mutation constructs were generated using mutated oligonucleotides and pGL3–956/+92 by PCR. Two overlapping PCR products were generated using the following sets of primers. The amplified fragment was digested with MluI and XhoI and then into the pGL3-basic vector (Promega). Bases within these oligonucleotides were changed in the two CRE sites (CGC to TAT [–922 region], TGA to GAC [901 region], and CGC to TAT [–901 region]) to generate the mutants pGL3-MUC5B CREM1 (M1), pGL3-MUC5B CREM2 (M2), and pGL3-MUC5B CREM3 (M3). All of them were sequenced.
Cell Culture
Epithelia were isolated from scrapings of the inferior turbinate of eight healthy adult volunteers, four men and four premenopausal women. None of the volunteers had any history of allergic symptoms, nasal polyps, or asthma. They did not have a history of smoking and did not take any medicines for the past 6 months. The volunteers' permission and the approval from the Institutional Review Board at Yonsei University College of Medicine were obtained for the use of the specimens. The epithelial cells from the turbinates were treated with 1% Pronase (Type XIV protease; Sigma-Aldrich Chemical Co., St. Louis, MO) for 18 to 20 hours at 4°C. To remove fibroblasts, endothelial cells, and myoepithelial cells, isolated cells were placed in a plastic dish and cultured for 1 hour at 37°C. Isolated epithelial clusters were divided into single cells by incubating them with 0.25% trypsin/EDTA. Passage-2, normal human nasal epithelial (NHNE) cells were seeded in 0.5 ml of culture medium onto 24.5-mm, 0.45-µm pore size Transwell clear culture inserts. Cells were cultured in a 1:1 mixture of bronchial epithelial cell growth medium (Clonetics, San Diego, CA) and Dulbecco's modified Eagle's medium (Invitrogen, San Diego, CA) containing all supplements described previously (36). The Cultures were grown submerged for the first 9 days, during which time the culture medium was changed on Day 1 and every other day thereafter. The air–liquid interface (ALI) was created on Day 9 by removing the apical medium and feeding the cultures only from the basal compartment. The culture medium was changed daily after creation of an ALI. NHNE cells were treated on 7 days after confluence for all experiments, indicating that NHNE cells were in a differentiated state at the time of treatment. For transfection study, we selected NCI-H292 cells because the results in both NHNE and NCI-H292 cells were the same. The human lung mucoepidermoid carcinoma cell line, NCI-H292, was purchased from the American Type Culture Collection (ATCC, catalog no. CRL-1848; Manassas, VA) and cultured in RPMI 1640 (Invitrogen) supplemented with 10% fetal bovine serum (FBS) (Invitrogen) in the presence of penicillin-streptomycin at 37°C in a 5% CO2 humidified chamber. DLD-1 cells were also obtained from ATCC (catalog no. CCL-221). For all experiments involving cell culture, phenol-red free RPMI-1640 (Invitrogen) supplemented with 5% dextran/charcoal–treated FBS (Hyclone, Logan, UT) was used.
RT-PCR
Total RNA was isolated using TRIzol (Invitrogen) from NHNE cells treated with E2 (10–9 M). cDNA was synthesized with random hexamers (PerkinElmer Life Sciences, Boston, MA and Roche Applied science, Indianapolis, IN) using Moloney murine leukemia virus-reverse transcriptase (PerkinElmer Life Sciences). Oligonucleotide primers for PCR were designed based on the GenBank sequence of MUC5B (GenBank accession no. AJ012453, 5' primer CTG CGA GAC CGA GGT CAA CAT C; 3' primer TGG GCA GCA GGA GCA CGG AG). The following PCR conditions used involved 35 cycles: denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and polymerization at 72°C for 30 seconds. The oligonucleotide primers for β2-microglobulin (used as a control gene for the RT-PCR) were designed based on the GenBank human sequence (GenBank accession no. XM007650, 5' primer CTCGCGCTACT CTCTTTCTGG; 3' primer GCTTACATGTCTCGATCCCACTTAA). PCR parameters used involved 23 cycles as follows: denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 30 seconds. The PCR products were run in a 1.5% agarose gel and visualized with ethidium bromide under a transilluminator.
Real-Time Quantitative PCR
Primers and probes were designed using the PerkinElmer Life Science Primer Express software purchased from PE Biosystems (Foster City, CA). Commercial reagents (TaqMan PCR Universal PCR master mix; PE biosystems) and conditions were applied according to the manufacturer's protocol. Three micrograms of cDNA (reverse transcription mixture), oligonucleotides at a final concentration of 800 nM for each primer, and 200 nM TaqMan hybridization probe were used in a 25-µl volume. The probe for real-time PCR was labeled with carboxylfluorescein (FAM) at the 5'-end and with the quencher carboxytetramethylrhodamine (TAMRA) at the 3'-end. The following primers and TaqMan probes were used: MUC5B, forward (5'-CTACCTGGAC AACC ACTACTGC-3'), MUC5B, reverse (5'-TGGTGACAGTGAGGACGATATCC-3') and TaqMan probe (FAM-CTGCCACTGCCGCTGCCGCC-TAMRA), β 2-microglobulin (B2M), forward (5'-CGCTCCGTGGCCTTAGC-3') and β 2-microglobulin (B2M), reverse (5'-GAGTACGCTGGAT AGCCTCCA-3') and TaqMan probe (FAM-TGCTCGCGCTACTCTCTCTTTCTGGC-TAMRA). Real-time PCR was performed on a PE Biosystems ABI PRISM 7300 sequence detection system. The thermocycler parameters were 50°C for 2 minutes and 95°C for 10 minutes followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute All reactions were performed in triplicate. The relative quantity of MUC5B mRNA was determined using a comparative threshold method, and the results normalized against β2-microglobulin as an internal control. Data were analyzed using the Student's t test for paired and unpaired values.
Western Blot Analysis
NCI-H292 cells were grown to confluence in 6-well plates. After treatment with 10–9 M E2, the cells were lysed in 1x lysis buffer (125 mM Tris, pH 7.8, 10 mM EDTA, 10 mM DTT, 50% glycerol, and Triton X-100). Equal amounts of whole cell lysates were resolved by 10% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Millipore, Billerica, MA). The membrane was blocked with 5% skim milk in Tris-buffered saline (TBS, 50 mM Tris-Cl, pH 7.5 and 150 mM NaCl) for 2 hours at room temperature, followed by overnight incubation with primary antibodies in TBS-T (0.5% Tween 20 in TBS). After washing with TBS-T, the blots were incubated with anti-rabbit or anti-mouse antibody (Cell Signaling Technology, Beverly, MA) in TBS-T for 1 hour at room temperature and visualized with enhanced chemiluminescence reagent (Santa Cruz Biotechnology, Santa Cruz, CA).
Immunodetection and Quantitation of MUC5B Mucin Secretion
The immunodot blotting assay for detection of secreted mucin and intracellular mucin produced by cultured cells has been described previously in detail (37). Briefly, MUC5B mucin was determined using an anti-human MUC5B antibody (catalog no. sc-21768; Santa Cruz). Dilutions of apical secretions and standards were applied to a nitrocellulose membrane, and then incubated with the appropriate primary antibodies. This was followed by reaction with horseradish peroxidase–conjugated goat anti-mouse or anti-rabbit IgG. The signal was detected by chemiluminescence (ECL kit; Amersham, Little Chalfont, UK) and the relative fold increase was calculated by dividing E2-treated signal into control signal, since there is no commercially available MUC5B protein for standardization. The data were represented as mean ± SD of triplicate cultures from the same experiment.
Immunofluorescence Microscopy
For the histologic study, cells were washed three times with PBS and fixed in 3% paraformaldehyde solution (3% [wt/vol] paraformaldehyde, 0.1 mM CaCl2, and 0.1 mM MgCl2, pH 7.4, in PBS) for 10 minutes. The cells were washed three times with PBS, permeabilized in 0.2% Triton X-100/PBS for 5 minutes, and washed three times with PBS. The cells were then blocked with 10% normal goat serum (Jackson Immuno Research labs Inc., West Grove, PA) for 1 hour, then washed with PBS. ER- proteins were detected using the phospho–ER- polyclonal antibody (1:75; Cell Signaling Technology), and incubated for 24 hours at 4°C, followed by washes in PBS. The aforementioned procedure was repeated with an appropriate fluorescein isothiocyanate (FITC)-conjugated secondary antibody (1:100; Jackson Immuno Research Labs). Cell nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI), and the coverslips were mounted on slides with Vectashield Mounting Medium (Vector Larboratories, Inc., Burlingame, CA) and examined using a Zeiss LSM 510 confocal microscope (Carl Zeiss, Inc., Minneapolis, MN).
Transient Transfection and Luciferase Analysis
NCI-H292 cells seeded (105 cells/well) in 6-well tissue culture plates, 1 day before transfection. The cells were transfected using FuGENE6 Transfection Reagent (Roche Applied Science, Indianapolis, IN) according to the manufacturer's recommendations. Three microliters of FuGENE6 and 1 µg of plasmid DNA (pGL3-basic [Promega, Madison, WI], pGL3-MUC5B [–1329/+92], pGL3-MUC5B [–956/+92], pGL3-MUC5B [–649/+92], pGL3-MUC5B CREM1, pGL3-MUC5B CREM2, and pGL3-MUC5B CREM3) were diluted individually in 100-µl aliquots of OptiMEMSerum I Reduced-Serum Medium (Invitrogen). Cells were incubated with DNA lipid complexes for 4 hours and then fed RPMI 1640 (Invitrogen) 24 h after transfection, treated with 10–9 M of E2 for 24 hours, harvested, and assayed for luciferase activity using the luciferase assay system (Promega) according to the manufacturer's instructions. β-galactosidase (Promega) activity was also assayed to standardize sample transfection efficiencies. To confirm that the luciferase activity of each construct was caused by E2, the activity of each construct was assayed in the absence of E2.
Small Interfering RNA Treatment
The role of ERK1/2 in mediating the estrogen effects was examined using ERK1-small interfering (si)RNA (siERK1) or ERK2-siRNA (siERK2) to silence the ERK1 or ERK2 gene. The siERK1 (catalog no. sc-29307), siERK2 (catalog no. sc-35335), and siRNA negative control (catalog no. sc-37007) were purchased from Santa Cruz Biotechnology. The role of RSK1 in mediating the estrogen effects was examined using RSK1-siRNA (siRSK1) to silence the RSK1 gene. The siRSK1 gene sequence used was AAU UGU CUC CUU UAC CAC GUA GCC G, and siRSK1 (Stealth, human CREB gene Acc no. NM001006665) was chemically synthesized by Invitrogen Research. The role of CREB in mediating the estrogen effects was examined using CREB-siRNA (siCREB) to silence the CREB gene. The siCREB gene sequence used was UUA CAG CUG CAU CUC CAC UCU GCU G, and siCREB (Stealth, human CREB gene Acc no. NM134442.2) was chemically synthesized by Invitrogen Research. The siRNA negative control (Stealth, catalog no. 12935–300; Invitrogen) was used. NCI-H292 cells were seeded the night before transfection at a density of 30 to 50% confluence by the time of transfection. Forty nanomoles of siERK1/2, siRSK1, siCREB, and siRNA negative control were used for transfection using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Transfected cells were maintained in culture for 3 days before harvesting and further analyses. The efficiency of the siRNA knockdown was determined by Western blot analysis with the antibodies.
ChIP Assays
For ChIP assays, chromatin was isolated as described elsewhere (38). In brief, approximately 2 x 109 NCI-H292 cells in 150-mm dishes were treated with PBS containing 1% formaldehyde for 10 minutes, washed twice with PBS, and fixed with 125 mM glycine at room temperature for 5 minutes. The cells were rinsed twice with PBS and resuspended in 1 ml of solution A (10 mM HEPES, pH 6.5, 0.25% Triton X-100, 10 mM EDTA, 0.5 mM EGTA) by pipetting. After a short spin (5 min at 3,000 rpm), the pellets were resuspended in solution B (10 mM HEPES, pH 6.5, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA) containing protease inhibitors, by vigorous pipetting to extract nuclear proteins. After centrifuging at 4,000 rpm for 5 minutes, the nuclear pellets were resuspended in immunoprecipitation buffer (10 mM EDTA, 50 mM Tris-HCl, pH 8.1, 1% SDS, 0.5% Empigen BB) containing protease inhibitors, and sonicated to break the chromatin into fragments with an average length of 0.5 to 1 kb. The following antibodies were used in the assay: 2 µg of anti–phospho-CREB (Ser-133) antibody and 2 µg of rabbit IgG as a negative control. The CRE (–956 to –753) primers used for ChIP analysis PCR reaction are as follows: forward (5'-ACGCGTGAGGTATTGCAGCGCGGACG-3') and reverse (5'-GGTTGAGGAAGCAGCTGCTC-3'), with the PCR product being 203 bp. We also designed the primers for the negative controls (–3960 to –3761) to amplify the DNA fragment upstream of the CRE element: forward (5'-CCAGGCACTGGCTCTGAGA-3') and reverse (5'-GAGGGTCCCATCGTGTGAC-3'), yielding a PCR product of 199 bp.
Statistical Analysis
The statistical significance of the difference between groups was estimated by Wilcoxon signed rank test.
 |
RESULTS
|
|---|
E2 Induces MUC5B Gene Expression and Intracellular MUC5B Mucoprotein in NHNE Cells
E2 is known to rapidly induce cytoplasmic signal transduction pathways, resulting in the phosphorylation of target proteins. To determine whether E2 can induce MUC5B gene expression and MUC5B protein production within NHNE cells, RT-PCR and immunoblotting were performed after treating the cells with various concentrations of E2. As the dose of E2 was increased from 10–10 to 10–8 M, the level of MUC5B gene expression gradually increased and intracellular MUC5B protein expression reached a plateau at 10–9 M, being increased by 3- fold (Figures 1A and 1B). Accordingly, 10–9 M E2 was used for all subsequent experiments. To determine whether E2 induced MUC5B gene expression in a time-dependent manner, MUC5B gene expression was examined after exposure to 10–9 M E2 for various periods. The level of MUC5B gene expression gradually increased in a time-dependent manner and MUC5B mucin production was increased 3.1-fold after a 24-hour exposure to E2 (Figures 1C and 1D). The specimens were from four men and four premenopausal women, but there was no sex difference to be seen.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 1. Effect of E2 on MUC5B gene expression and intracellular MUC5B mucoprotein in normal human nasal epithelial (NHNE) cells. (A and B) Cells were treated with E2 (10–10, 10–9, and 10–8 M) for 24 hours. (C and D) Cells were treated with E2 (10–9 M) for 0, 3, 6, 12, and 24 hours, and total RNA was harvested for RT-PCR, while cell lysates were harvested for immunodot blot analysis as described in MATERIALS AND METHODS. Expression of β2-microglobulin (β2-M) was analyzed as a control. E2 increased (A and C) MUC5B gene expression and (C and D) MUC5B mucin production. Data are expressed as mean ± SD of triplicate cultures from two different donors. At least three separate experiments were performed for each measurements. * P < 0.05 statistically different from the EtOH control.
|
|
E2 Increases ER Ser118 Phosphorylation
Activation of Ser118 in the N-terminal activation function 1 domain of ER is related to the phosphorylation of MAPK (38). We observed that E2 rapidly induced phosphorylation of ER Ser118 in NHNE cells, with a peak in detectable p-ER between 5 and 20 minutes after the introduction of E2 (Figure 2A). To determine whether ICI 182,780, a specific ER and ERβ antagonist, inhibited ER -Ser118 phosphorylation, NHNE cells were treated with 5 µM ICI 182,780. ICI 182,780 inhibited ER -Ser118 phosphorylation induced by E2 (Figure 2B) and suppressed E2-induced MUC5B gene expression and p-ERK1/2 activation (Figure 2C), indicating that E2-induced MUC5B gene expression was ER -mediated. Furthermore, immunofluorescent double staining was used for the cellular location of p-ER -Ser118 in NHNE cells treated with E2 in the absence or presence of ICI 182,780 (Figure 2D). Upon E2 stimulation, p-ER -Ser118 was increased in the cytoplasm, which was associated with cytoplasmic re-localization of ER . ICI 182,780 inhibited E2-induced ER -Ser118 phosphorylation. These results suggest that upon E2 stimulation, activated ER -Ser118 is accumulated in the cytoplasm.


View larger version (73K):
[in this window]
[in a new window]
|
Figure 2. Effect of ICI 182,780 on MUC5B gene expression in NHNE cells. (A) Cells were treated with E2 (10–9 M) for 5, 10, 20, 30, and 60 minutes, and total cell lysates were processed for Western blot analysis as described in MATERIALS AND METHODS; -tubulin was used as an internal control. Confluent cells were pretreated for 1 hour with 5 µM ICI 182,780 and stimulated for 10 minutes with E2 (10–9 M) before the collection of cell lysates for Western blot analysis. (B) -tubulin was used as an internal control. Panels A and B are representatives of three independent experiments, respectively. (C) Upper panel: cells were pretreated for 1 hour with 5 µM ICI 182,780 and stimulated for 24 hours with E2 (10–9 M) before collection for real-time quantitative PCR. Lower panel: pretreated cells were stimulated for 10 minutes with E2 (10–9 M) before collection for Western blot analysis. Western blot analysis for p-ERK/ERK proteins and quantitation of the p-ERK/ERK ratio are shown. Data are expressed as mean ± SD of triplicate cultures from two different donors. At least three separate experiments were performed for each measurement. * P < 0.05 statistically different from the EtOH control. The cellular localization of the ER in NHNE was analyzed by immunofluorescent staining. Note that ICI 182,780 inhibits E2-induced ER phosphorylation at 10 minutes (D). D is representative of three independent experiments.
|
|
E2 Induces MUC5B Gene Expression via ERK1/2 MAPK Signaling
To investigate which MAPK signal pathway was activated by E2 in NHNE cells and NCI-H292 cells, Western blot analysis was performed was using phospho-specific antibodies. As shown in Figure 3A, E2 activated ERK1/2 MAPK in both NHNE cells and NCI-H292 cells (data not shown) with a peak activation at 10 minutes. Activation of MAPK was decreased at 30 minutes. However, no change was detected in the activation of phospho-p38 or c-Jun NH2-terminal kinase. E2-treated DLD-1 cells were used as a positive control for p38 kinase activation. A densitometric analysis of the Western blots showed a significant decrease in p-ERK1/2 (Figure 3B).
To investigate the possible involvement of the ERK1/2 MAPK pathway in E2-induced MUC5B gene expression, the real-time PCR indicated that pretreatment with 30 µM PD98059 for 1 hour inhibited MUC5B gene expression (Figure 3C, upper panel) and p-ERK1/2 and p-RSK1 activation (Figure 3C, lower panel). RSK1 is a downstream of ERK MAPK. These results indicate that the activation of ERK1/2 MAPK is closely related to E2-induced MUC5B gene expression. For further confirmation, the NCI-H292 cells were transfected with siRNA ERK1, siRNA ERK2, or siRNA-negative control. The siRNA ERK1 or siRNA ERK2 transfection was found to suppress E2-induced ERK1, ERK2 MAPK, and RSK1 (Figure 3D, lower panel). Moreover, siRNA ERK1 and ERK2 suppressed E2-induced MUC5B gene expression (Figure 3D, upper panel). These results indicate that the activation of ERK1/2 MAPK via MEK1 is essential for E2-induced MUC5B gene expression in NCI-H292 cells.
RSK1 Is Required for E2-Induced MUC5B Gene Expression
To identify the molecules involved in the downstream signaling of ERK1/2 MAPK in E2-induced MUC5B gene expression, RSK1 and MSK1 which are substrates of CREB were examined. MSK1 did not affect E2-induced MUC5B gene expression (data not shown). The phosphorylation of RSK1 by E2 peaked at 10 minutes and decreased by 60 minutes after E2 stimulation (Figure 4A). A densitometric analysis of the Western blots showed a significant increase in p-RSK1 at 10 minutes (Figure 4B). These results suggest that RSK1 acts as a downstream signaling mediator of ERK1/2 MAPK. To determine whether RSK1 plays an important role in E2-induced MUC5B gene expression, an RSK1 silencing study was performed, as RSK1 is a mediator of cytokine-induced CREB phosphorylation at Ser 133. To test the effect and specificity of the siRNA, cells were transfected with 40 nM of siRNA against RSK1 or a negative control. Twenty-four hours after transfection, cells were treated with E2 and harvested for Western blot analysis. siRNA specific for RSK1 suppressed the levels of p-RSK1, while the siRNA-negative control exerted no effect. We also showed that siRSK1 did not affect the phospholylation of ERK1/2 (Figure 4C, lower panel). Knocking down RSK1 led to a decreased level of the MUC5B gene expression as assessed by quantitative real-time PCR, while the negative control showed no effect (Figure 4C, upper panel). To determine whether ICI 182,780 inhibited RSK1 phosphorylation, NHNE cells were treated with 5 µM ICI 182,780. ICI 182,780 inhibited RSK1 phosphorylation induced by E2 (Figure 4D), indicating that E2-induced RSK1 phosphorylation was ER mediated. These results indicate that RSK1 is an essential downstream mediator of ERK MAPK signaling for E2-induced MUC5B gene expression.

View larger version (49K):
[in this window]
[in a new window]
|
Figure 4. Effect of RSK1 on E2-induced MUC5B gene expression. (A) NHNE cells were stimulated for the indicated times with E2, and total cell lysates were processed for Western blot analysis as described in MATERIALS AND METHODS; -tubulin was used as an internal control. (B) Quantitation of the p-RSK1/RSK1 ratio. Data are expressed as mean ± SD of triplicate cultures from two different donors. (C) Upper panel: NCI-H292 cells were transfected with siRSK1 and stimulated with E2 for 24 hours before real-time quantitative PCR. Lower panel: transfected cells were stimulated with E2 for 10 minutes before Western blot analysis. Data are expressed as mean ± SD of triplicate cultures. (D) NHNE cells were pretreated for 1 hour with 5 µM ICI 182,780 and stimulated for 10 minutes with E2 (10–9 M) before the collection of cell lysates for Western blot analysis. At least three separate experiments were performed for each measurement. * P < 0.05 statistically different from the EtOH control.
|
|
Effect of CREB on E2-Induced MUC5B Gene Expression
To determine if CREB plays a role in E2-induced MUC5B gene expression, Western blot analysis was performed using an anti–phospho-CREB antibody. The phosphorylation of CREB by E2 peaked at 20 minutes and decreased at 40 minutes (Figure 5A). A densitometric analysis of the Western blots showed a significant increase in p-CREB at 20 minutes (Figure 5B). To test the role of CREB in transcriptional regulation by E2, siRNA was used to knock down CREB in NCI-H292 cells. Twenty-four hours after transfection, cells were treated with E2 and harvested for western blot analysis. siRNA specific for CREB suppressed the levels of p-CREB, while the siRNA negative control exerted no effect. We also showed that siCREB did not affect the phosphorylation of RSK1 (Figure 5C, lower panel). Knocking down CREB led to a decreased level of the MUC5B gene expression as assessed by quantitative real-time PCR, while the negative control showed no effect (Figure 5C, upper panel). To determine whether ICI 182,780 inhibited CREB phosphorylation, NHNE cells were treated with 5 µM ICI 182780. ICI 182,780 inhibited CREB phosphorylation induced by E2 (Figure 5D), indicating that E2-induced CREB phosphorylation was ER -mediated. These results indicate that activation of CREB is essential for E2-induced MUC5B gene expression by ERK MAPK and RSK1.

View larger version (49K):
[in this window]
[in a new window]
|
Figure 5. Effect of CREB on E2-induced MUC5B gene expression. (A) NHNE cells were treated with E2 (10–9 M) for 10, 20, 30, 40, and 60 minutes, and total cell lysates were processed for Western blot analysis as described in MATERIALS AND METHODS; -tubulin was used as an internal control. (B) Quantitation of the p-CREB/CREB ratio. Data are expressed as mean ± SD of triplicate cultures from two different donors. (C) Lower panel: NCI-H292 cells were transfected with siCREB (40 nM) or siRNA-negative control (40 nM) and stimulated with E2 (10–9 M) for 20 minutes before Western blot analysis. Upper panel: transfected cells were stimulated with E2 for 24 hours before real-time quantitative PCR. Data are expressed as mean ± SD of triplicate cultures. (D) NHNE cells were pretreated for 1 hour with 5 µM ICI 182,780 and stimulated for 20 minutes with E2 (10–9 M) before the collection of cell lysates for Western blot analysis. At least three separate experiments were performed for each measurement. * P < 0.05 statistically different from the EtOH control.
|
|
CRE Is Required for E2-Induced MUC5B Transcription
Various promoter deletion clones, such as –956 to +92, and –649 to +92, were constructed based on the –1,329 to +92 clone. NCI-H292 cells were transiently transfected with these constructs and treated with E2 (10–9 M) for 24 hours. As shown in Figure 6A, E2 selectively increased the luciferase activity of the –956 to –649 region of the MUC5B promoter. However, its effect was reduced on fragments covering the –649 to +92 region, suggesting that the –956 to –649 region of the MUC5B promoter is required for responding to E2.


View larger version (32K):
[in this window]
[in a new window]
|
Figure 6. CRE is required for E2-induced MUC5B transcription. (A) NCI-H292 cells were transiently transfected with various MUC5B promoter luciferase reporter constructs, and stimulated with E2 for 24 hours. Luciferase activity was then measured in E2-treated and -untreated cells. (B) Cells were transfected with the MUC5B promoter constructs containing mutated CRE sites as indicated. The luciferase activities displayed were corrected for transfection efficiency using the β-galactosidase activity of the cell lysates to standardize the values. Data are expressed as mean ± SD of triplicate cultures. At least three separate experiments were performed for each measurement. * P < 0.05 statistically different from the EtOH control. (C) The ChIP assays were transfected with siRNA control and siCREB, then treated with E2 (10–9M) for 20 minutes. The cells were immunoprecipitated using CREB antibody or control IgG that either amplified the CREB-binding flanking region in MUC5B promoter (CRE site) or a region further upstream that does not contain a CREB-binding site (Non-CRE site). ChIP assays were performed as described in MATERIALS AND METHODS. IgG, Goat antirabbit IgG (negative control for ChIP).
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Figure 7. The signaling pathway of E2-induced MUC5B gene expression in human airway epithelial cells. E2 activates cytoplasmic ER. Then, activated ER induces MUC5B gene expression through ERK MAPK/RSK1/CREB activation sequentially. Two CRE sites in the MUC5B promoter play a key role in these processes by binding CREB.
|
|
Moreover, we examined whether activation of CRE is required for E2-induced MUC5B transcription by performing selective mutagenesis of the CREB-binding site. As shown in Figure 6B, mutant constructs of CRE site in the MUC5B promoter, namely CREM1 (M1), CREM2 (M2), and CREM3 (M3) reduced responsiveness relative to the wild-type MUC5B promoter construct (Figure 6B). These results show that CRE in the regulatory region of the MUC5B promoter is critical for the up-regulation of MUC5B transcriptional activity by E2. In addition, we used siRNA to knock down CREB in NCI-H292 cells. To test the effect of siRNA, the cells were transfected with siRNA against CREB and control. Three days later, the cells were induced without or with E2 for 20 minutes, and processed for ChIP using an anti–phospho-CREB antibody, and the purified genomic DNA was amplified with primers specific to the MUC5B promoter (–956/–649). CREB led to an increase in the binding of CRE to the MUC5B promoter. However, the binding of CREB was abolished by treatment with siCREB, confirming the effectiveness and specificity of the siRNA (Figure 6C). These data suggest that CREB binds to the CRE on the MUC5B promoter.
 |
DISCUSSION
|
|---|
In this report, we focused on the mechanism and expression of MUC5B gene in human airway epithelial cells. Mucin hypersecretion can cause many clinical problems, such as rhinosinusitis, asthma, chronic obstructive pulmonary disease (COPD), and cystic fibrosis. It has been reported that MUC5B is one of the major components in the human airway epithelium (39–41). However, the molecular mechanism of MUC5B gene expression up-regulation by inflammatory stimuli remains poorly understood.
We used E2 as a stimulant in normal human nasal epithelial cells. This stimulation led to an increase in MUC5B mucoprotein secretion. This increase in protein production was shown to be dependent on ER -Ser118 activation leading to MUC5B gene expression. These data suggest that E2 activate nongenomic ER pathway. Supporting these findings, we also show that the ER antagonist ICI 182,780 blocked E2-induced activation of the MUC5B gene expression. ICI 182,780 is a novel ER antagonist that is devoid of the agonistic effects possessed by other anti-estrogens such as tamoxifen, and also 100-fold greater ER-binding affinity than tamoxifen. Levin (32) reported that ICI 182,780 blocked rapid nongenomic actions of E2 in various cell types.
We also show that E2 triggered a transient activation of ERK1/2, a member of the MAPK pathway. Again, phosphorylation of ER preceded the activation of ERK1/2 and the subsequent up-regulation of MUC5B gene expression. Treatment of various cell types with E2 has been shown to activate a number of cell signaling pathways, including the phosphatidylinositol-3-kinase (PI3K) pathway (42).
E2 was shown in this study to only activate ERK MAP kinase in MUC5B gene expression, although several studies (43, 44) have suggested that more than one MAPK is necessary for the signal transduction of various inflammatory mediators. Recently, Chen and coworkers (26) also reported that IL-17 induced MUC5B gene expression through Janus kinases (JAK) 2 and ERK MAPK in human, monkey, and mouse airway tissues. MUC5B gene expression was increased by defensin or uridine 5'-triphosphate (UTP) through ERK1/2 MAPK pathway (26). In addition, our previous work on MUC5AC gene expression (45) showed that cytokines such as IL-β and TNF-a activate at least two MAP kinases: ERK and p38 MAPK. These finding support the notion that ERK MAPK is an important signaling molecule in MUC5B gene expression.
The downstream signaling molecules of ERK MAPK were investigated. In the present study, RSK1 and CREB were identified as essential downstream molecules of ERK MAPK activation in E2-induced MUC5B gene expression. RSK1 is known to be regulated by MAPK/ERK, and is currently the best candidate for mediation of cytokine-induced CREB phosphorylation at Ser133 (46, 47). RSK1 phosphorylates several transcription factors—for example, CREB (48), c-Fos (49), CCAAT/enhancer-binding protein (50), and the estrogen receptor (51)—and interacts with transcriptional coactivator CREB-binding protein (also known as p300) (52). Also, CREB is a potent regulator of the expression of mucin genes (MUC2, MUC5AC, MUC5B, and MUC6) in the p15 arm of chromosome 11 (11p15) (53). Recently, Song and colleagues (45) reported that IL-1β and TNF- induced MUC5AC gene expression through CREB phosphorylation in primary human nasal epithelial cells and NCI-H292 cells. In addition, Cho and coworkers (54) reported that CREB activation is required for PGE2-induced MUC8 gene expression. These findings support the findings of this study that CREB activation is involved in the downstream signaling of ERK MAPK and RSK1 for E2-induced MUC5B gene expression. Interestingly, Van Seuningen and colleagues (53) reported that co-transfection of Sp1 with fragment 1,896 (–956/–1) led to an increase of MUC5B gene expression in mucus-secreting LS173T and Caco-2 cells, suggesting that Sp1 may also be an important transcription factor. Taken together, these findings suggest that CREB may interact directly or indirectly with other transcriptional factors and that non–DNA-binding transcriptional co-activators which were thought to function as bridging proteins between DNA-binding transcription factors and basal transcription factors, play a role as integrators and of diverse signaling pathways in the MUC5B gene expression.
The results indicate that the –956/–753 region of the MUC5B promoter is critical for E2-induced MUC5B gene expression. In this region of the MUC5B promoter, there are two possible CREB-binding sites in the –922 and –901 region. In addition, since point mutation of each CRE site in MUC5B promoter showed significant suppression of the luciferase activity in our study, it can be inferred that both of these sites are important for E2-induced MUC5B gene expression.
In summary, our results show that ERK MAPK is essential for E2-induced MUC5B gene expression. Furthermore, activation of RSK1 and CREB is a crucial aspect of the intracellular mechanism and CRE in the MUC5B promoter might play a role in these processes by binding CREB (Figure 7). This is the first study to report E2-induced MUC5B gene expression occurring by nongenomic action.
 |
Footnotes
|
|---|
* These two authors were contributed equally to this work. 
This work was supported by the Korea Research Foundation Grants KRF-2005-015-E00163 and the Korea Science and Engineering Foundation (KOSEF) grant funded by the Korea government (MOST) (R11-2007-040-02001-0).
Originally Published in Press as DOI: 10.1165/rcmb.2007-0377OC on August 7, 2008
Conflict of Interest Statement: None of the authors has a financial relationship with a commercial entity that has an interest in the subject of this manuscript.
Received in original form September 18, 2007
Accepted in final form July 18, 2008
 |
References
|
|---|
- Kim SS, Kim KS, Lee JG, Park IY, Koo JS, Yoon JH. Levels of intracellular protein and messenger RNA of mucin and lysozyme in normal human nasal and polyp epithelium. Laryngoscope 2000;110:276–280.[CrossRef][Medline]
- Chung MH, Choi JY, Lee WS, Kim HN, Yoon JH. Compositional difference in middle ear effusion: mucous versus serous. Laryngoscope 2002;112:152–155.[CrossRef][Medline]
- Yuta A, Ali M, Sabol M, Gaumond E, Baraniuk JN. Mucoglycoprotein hypersecretion in allergic rhinitis and cystic fibrosis. Am J Physiol 1997;273:L1203–L1207.[Medline]
- Majima Y, Sakakura Y, Matsubara T, Miyoshi Y. Possible mechanisms of reduction of nasal mucociliary clearance in chronic sinusitis. Clin Otolaryngol 1986;11:55–60.[Medline]
- Voynow JA, Selby DM, Rose MC. Mucin gene expression (MUC1, MUC2, and MUC5/5AC) in nasal epithelial cells of cystic fibrosis, allergic rhinitis, and normal individuals. Lung 1998;176:345–354.[CrossRef][Medline]
- Spicer AP, Parry G, Patton S, Gendler SJ. Molecular cloning and analysis of the mouse homologue of the tumor-associated mucin, MUC1, reveals conservation of potential O-glycosylation sites, transmembrane, and cytoplasmic domains and a loss of minisatellite-like polymorphism. J Biol Chem 1991;266:15099–15109.[Abstract/Free Full Text]
- Gum JR Jr, Hicks JW, Toribara NW, Siddiki B, Kim YS. Molecular cloning of human intestinal mucin (MUC2) cDNA: identification of the amino terminus and overall sequence similarity to prepro-von Willebrand factor. J Biol Chem 1994;269:2440–2446.[Abstract/Free Full Text]
- Van Klinken BJ, Dekker J, Van Gool SA, Van Marle J, Buller HA, Einerhand AW. MUC5B is the prominent mucin in human gallbladder and is also expressed in a subset of colonic goblet cells. Am J Physiol 1998;274:G871–G878.[Medline]
- Moniaux N, Nollet S, Porchet N, Degand P, Laine A, Aubert JP. Complete sequence of the human mucin MUC4: a putative cell membrane-associated mucin. Biochem J 1999;338:325–333.[CrossRef][Medline]
- Van de Bovenkamp JH, Hau CM, Strous GJ, Buller HA, Dekker J, Einerhand AW. Molecular cloning of human gastric mucin MUC5AC reveals conserved cysteine-rich D-domains and a putative leucine zipper motif. Biochem Biophys Res Commun 1998;245:853–859.[CrossRef][Medline]
- Keates AC, Nunes DP, Afdhal NH, Troxler RF, Offner GD. Molecular cloning of a major human gall bladder mucin: complete C-terminal sequence and genomic organization of MUC5B. Biochem J 1997;324:295–303.[Medline]
- Ho SB, Roberton AM, Shekels LL, Lyftogt CT, Niehans GA, Toribara NW. Expression cloning of gastric mucin complementary DNA and localization of mucin gene expression. Gastroenterology 1995;109:735–747.[CrossRef][Medline]
- Bobek LA, Tsai H, Biesbrock AR, Levine MJ. Molecular cloning, sequence, and specificity of expression of the gene encoding the low molecular weight human salivary mucin (MUC7). J Biol Chem 1993;268:20563–20569.[Abstract/Free Full Text]
- Shankar V, Pichan P, Eddy RL Jr, Tonk V, Nowak N, Sait SN, Shows TB, Schultz RE, Gotway G, Elkins RC, et al. Chromosomal localization of a human mucin gene (MUC8) and cloning of the cDNA corresponding to the carboxy terminus. Am J Respir Cell Mol Biol 1997;16:232–241.[Abstract]
- Lapensee L, Paquette Y, Bleau G. Allelic polymorphism and chromosomal localization of the human oviductin gene (MUC9). Fertil Steril 1997;68:702–708.[CrossRef][Medline]
- Williams SJ, McGuckin MA, Gotley DC, Eyre HJ, Sutherland GR, Antalis TM. Two novel mucin genes down-regulated in colorectal cancer identified by differential display. Cancer Res 1999;59:4083–4089.[Abstract/Free Full Text]
- Williams SJ, Wreschner DH, Tran M, Eyre HJ, Sutherland GR, McGuckin MA. Muc13, a novel human cell surface mucin expressed by epithelial and hemopoietic cells. J Biol Chem 2001;276:18327–18336.[Abstract/Free Full Text]
- Pallesen LT, Berglund L, Rasmussen LK, Petersen TE, Rasmussen JT. Isolation and characterization of MUC15, a novel cell membrane-associated mucin. Eur J Biochem 2002;269:2755–2763.[Medline]
- Argueso P, Spurr-Michaud S, Russo CL, Tisdale A, Gipson IK. MUC16 mucin is expressed by the human ocular surface epithelia and carries the H185 carbohydrate epitope. Invest Ophthalmol Vis Sci 2003;44:2487–2495.[Abstract/Free Full Text]
- Moniaux N, Junker WM, Singh AP, Jones AM, Batra SK. Characterization of human mucin MUC17: complete coding sequence and organization. J Biol Chem 2006;281:23676–23685.[Abstract/Free Full Text]
- Wu GJ, Wu MW, Wang SW, Liu Z, Qu P, Peng Q, Yang H, Varma VA, Sun QC, Petros JA, et al. Isolation and characterization of the major form of human MUC18 cDNA gene and correlation of MUC18 over-expression in prostate cancer cell lines and tissues with malignant progression. Gene 2001;279:17–31.[CrossRef][Medline]
- Chen Y, Zhao YH, Kalaslavadi TB, Hamati E, Nehrke K, Le AD, Ann DK, Wu R. Genome-wide search and identification of a novel gel-forming mucin MUC19/Muc19 in glandular tissues. Am J Respir Cell Mol Biol 2004;30:155–165.[Abstract/Free Full Text]
- Higuchi T, Orita T, Nakanishi S, Katsuya K, Watanabe H, Yamasaki Y, Waga I, Nanayama T, Yamamoto Y, Munger W, et al. Molecular cloning, genomic structure, and expression analysis of MUC20, a novel mucin protein, up-regulated in injured kidney. J Biol Chem 2004;279:1968–1979.[Abstract/Free Full Text]
- Smirnova MG, Guo L, Birchall JP, Pearson JP. LPS up-regulates mucin and cytokine mRNA expression and stimulates mucin and cytokine secretion in goblet cells. Cell Immunol 2003;221:42–49.[CrossRef][Medline]
- Yoon JH, Kim KS, Kim HU, Linton JA, Lee JG. 1999 Effects of TNF-alpha and IL-1 beta on mucin, lysozyme, IL-6 and IL-8 in passage-2 normal human nasal epithelial cells. Acta Otolaryngol 2003;119:905–910.
- Chen Y, Zhao YH, Wu R. Differential regulation of airway mucin gene expression and mucin secretion by extracellular nucleotide triphosphates. Am J Respir Cell Mol Biol 2001;25:409–417.[Abstract/Free Full Text]
- Voynow JA, Young LR, Wang Y, Horger T, Rose MC, Fischer BM. Neutrophil elastase increases MUC5AC mRNA and protein expression in respiratory epithelial cells. Am J Physiol 1999;276:L835–L843.[Medline]
- Helmi AM, EI Ghazzawi IF, Mandour MA, Shehata MA. The effect of oestrogen on the nasal respiratory mucosa: an experimental histopathological and histochemical study. J Laryngol Otol 1975;89:1229–1241.[Medline]
- Fujimoto N, Suzuki T, Honda H, Kitamura S. Estrogen enhancement of androgen-responsive gene expression in hormone-induced hyperplasia in the ventral prostate of F344 rats. Cancer Sci 2004;95:711–715.[CrossRef][Medline]
- Audie JP, Janin A, Porchet N, Copin MC, Gosselin B, Aubert JP. Expression of human mucin genes in respiratory, digestive, and reproductive tracts ascertained by in situ hybridization. J Histochem Cytochem 1993;41:1479–1485.[Abstract]
- Gipson IK, Moccia R, Spurr-Michaud S, Argueso P, Gargiulo AR, Hill JA III, Offner GD, Keutmann HT. The Amount of MUC5B mucin in cervical mucus peaks at midcycle. J Clin Endocrinol Metab 2001;86:594–600.[Abstract/Free Full Text]
- Levin ER. Cell localization, physiology, and nongenomic actions of estrogen receptors. J Appl Physiol 2001;91:1860–1867.[Abstract/Free Full Text]
- Bryant DN, Sheldahl LC, Marriott LK, Shapiro RA, Dorsa DM. Multiple pathways transmit neuroprotective effects of gonadal steroids. Endocrine 2006;29:199–207.[CrossRef][Medline]
- Harvey BJ, Doolan CM, Condliffe SB, Renard C, Alzamora R, Urbach V. Non-genomic convergent and divergent signalling of rapid responses to aldosterone and estradiol in mammalian colon. Steroids 2002;67:483–491.[CrossRef][Medline]
- Keshamouni VG, Mattingly RR, Reddy KB. Mechanism of 17-beta-estradiol-induced Erk1/2 activation in breast cancer cells: a role for HER2 AND PKC-delta. J Biol Chem 2002;277:22558–22565.[Abstract/Free Full Text]
- Yoon JH, Kim KS, Kim SS, Lee JG, Park IY. Secretory differentiation of serially passaged normal human nasal epithelial cells by retinoic acid: expression of mucin and lysozyme. Ann Otol Rhinol Laryngol 2000;109:594–601.[Medline]
- Yoon JH, Gray T, Guzman K, Koo JS, Nettesheim P. Regulation of the secretory phenotype of human airway epithelium by retinoic acid, triiodothyronine, and extracellular matrix. Am J Respir Cell Mol Biol 1997;16:724–731.[Abstract]
- Yoon HG, Chan DW, Reynolds AB, Qin J, Wong J. N-CoR mediates DNA methylation-dependent repression through a methyl CpG binding protein Kaiso. Mol Cell 2003;12:723–733.[CrossRef][Medline]
- Sheehan JK, Howard M, Richardson PS, Longwill T, Thornton DJ. Physical characterization of a low-charge glycoform of the MUC5B mucin comprising the gel-phase of an asthmatic respiratory mucous plug. Biochem J 1999;338:507–513.[CrossRef][Medline]
- Thornton DJ, Howard M, Khan N, Sheehan JK. Identification of two glycoforms of the MUC5B mucin in human respiratory mucus. Evidence for a cysteine-rich sequence repeated within the molecule. J Biol Chem 1997;272:9561–9566.[Abstract/Free Full Text]
- Davies JR, Svitacheva N, Lannefors L, Kornfalt R, Carlstedt I. Identification of MUC5B, MUC5AC and small amounts of MUC2 mucins in cystic fibrosis airway secretions. Biochem J 1999;344:321–330.[CrossRef][Medline]
- Hennessy BA, Harvey BJ, Healy V. 17β-Estradiol rapidly stimulates c-fos expression via the MAPK pathway in T84 cells. Mol Cell Endocrinol 2005;229:39–47.[CrossRef][Medline]
- Bernatchez PN, Allen BG, Gélinas DS, Guillemette G, Sirois MG. Regulation of VEGF-induced endothelial cell PAF synthesis: role of p42/44 MAPK, p38 MAPK and PI3K pathways. Br J Pharmacol 2001;134:1253–1262.[CrossRef][Medline]
- Waetzig GH, Seegert D, Rosenstiel P, Nikolaus S, Schreiber S. p38 mitogen-activated protein kinase is activated and linked to TNF-alpha signaling in inflammatory bowel disease. J Immunol 2002;168:5342–5351.[Abstract/Free Full Text]
- Song KS, Lee WJ, Chung KC, Koo JS, Yang EJ, Choi JY, Yoon JH. Interleukin-1 beta and tumor necrosis factor-alpha induce MUC5AC overexpression through a mechanism involving ERK/p38 mitogen-activated protein kinases-MSK1-CREB activation in human airway epithelial cells. J Biol Chem 2003;278:23243–23250.[Abstract/Free Full Text]
- Aarbiou J, Verhoosel RM, Van Wetering S, De Boer WI, Van Krieken JH, Litvinov SV, Rabe KF, Hiemstra PS. Neutrophil defensins enhance lung epithelial wound closure and mucin gene expression in vitro. Am J Respir Cell Mol Biol 2004;30:193–201.[Abstract/Free Full Text]
- Caivano M, Cohen P. Role of mitogen-activated protein kinase cascades in mediating lipopolysaccharide-stimulated induction of cyclooxygenase-2 and IL-1 beta in RAW264 macrophages. J Immunol 2000;164:3018–3025.[Abstract/Free Full Text]
- Xing J, Ginty DD, Greenberg ME. Coupling of the RAS-MAPK pathway to gene activation by RSK2, a growth factor-regulated CREB kinase. Science 1996;273:959–963.[Abstract]
- Chen RH, Abate C, Blenis J. Phosphorylation of the c-Fos transrepression domain by mitogen-activated protein kinase and 90-kDa ribosomal S6 kinase. Proc Natl Acad Sci USA 1993;90:10952–10956.[Abstract/Free Full Text]
- Buck M, Poli V, van der Geer P, Chojkier M, Hunter T. Phosphorylation of rat serine 105 or mouse threonine 217 in C/EBP beta is required for hepatocyte proliferation induced by TGF alpha. Mol Cell 1999;4:1087–1092.[CrossRef][Medline]
- Joel PB, Smith J, Sturgill TW, Fisher TL, Blenis J, Lannigan DA. pp90rsk1 regulates estrogen receptor-mediated transcription through phosphorylation of Ser-167. Mol Cell Biol 1998;18:1978–1984.[Abstract/Free Full Text]
- Nakajima T, Fukamizu A, Takahashi J, Gage FH, Fisher T, Blenis J, Montminy MR. The signal-dependent coactivator CBP is a nuclear target for pp90RSK. Cell 1996;86:465–474.[CrossRef][Medline]
- Van Seuningen I, Pigny P, Perrais M, Porchet N, Aubert JP. Transcriptional regulation of the 11p15 mucin genes: towards new biological tools in human therapy, in inflammatory diseases and cancer? Front Biosci 2001;6:D1216–D1234.[Medline]
- Cho KN, Choi JY, Kim CH, Baek SJ, Chung KC, Moon UY, Kim KS, Lee WJ, Koo JS, Yoon JH. Prostaglandin E2 induces MUC8 gene expression via a mechanism involving ERK MAPK/RSK1/cAMP response element binding protein activation in human airway epithelial cells. J Biol Chem 2005;280:6676–6681.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
A. I. Malik and K. B. Storey
Activation of extracellular signal-regulated kinases during dehydration in the African clawed frog, Xenopus laevis
J. Exp. Biol.,
August 15, 2009;
212(16):
2595 - 2603.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2009 American Thoracic Society.
|